Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Serpin F1 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and F1 was purchased from Thermo Fisher Scientific (Australia) ...
-
bioRxiv - Immunology 2020Quote: ... CD85j/ILT2 (HP-F1, Super Bright 436, Invitrogen), NKp80 (5D12 ...
-
bioRxiv - Immunology 2020Quote: ... ILT-2 (CD85J) blocking antibody (clone HP-F1, ThermoFisher), CD155 blocking antibody (clone D171 ...
-
bioRxiv - Cell Biology 2022Quote: ... B16-F1 cells were cultured in DMEM GlutaMAX (Thermo Fisher Scientific, #31966047), supplemented with 10 % (v/v ...
-
bioRxiv - Genomics 2020Quote: ... f1 G8PPD plasmid (1.5 μg) were transfected into cells using Lipofectamine 3000 (Invitrogen). At 24 h post G8PPD transfection ...
-
bioRxiv - Evolutionary Biology 2020Quote: F1 juveniles were taken from Petri dishes and digested by proteinase (Thermo Fisher Science) to obtain genomic DNA as described previously (Ohta et al ...
-
bioRxiv - Microbiology 2021Quote: ... The L2 F1 worms were subjected to total RNA extraction with TRiZol reagent (Invitrogen).
-
bioRxiv - Cell Biology 2019Quote: ... B16-F1 cells and derivatives were cultured in DMEM (4.5 g/l glucose; Invitrogen), supplemented with 10% FCS (Gibco) ...
-
bioRxiv - Cell Biology 2020Quote: ... B16-F1 cells and derivatives were cultured in DMEM (4.5 g/l glucose; Invitrogen), supplemented with 10% FCS (Gibco) ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA from F1 heterozygotes was cloned into pCR™Blunt II-TOPO® vector (Thermofisher) and sequenced ...
-
bioRxiv - Immunology 2022Quote: ... CD85j (ILT2 or CD94) Peridinin chlorophyll protein (PerCP)-eFluor 710 (clone HP-F1, Thermo Fisher Scientific) and anti-CD107a BV605 (clone H4A3 ...
-
bioRxiv - Immunology 2022Quote: ... CD85j (ILT2 or CD94) Peridinin chlorophyll protein (PerCP)-eFluor 710 (clone HP-F1, Thermo Fisher Scientific). The following anti-human antibodies were used for intracellular cytokine staining ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was extracted from all F1 and parent plants using the KingFisher Flex (Thermo Fisher Scientific) and the BioSprint 96 DNA Plant Kit (QIAGEN) ...
-
bioRxiv - Plant Biology 2021Quote: ... P1 and P2) and were subsequently cloned into the donor vector pDONR221-f1 by BP clonase (Invitrogen) before transfer to pDRf1-GW (Loque et al. ...
-
bioRxiv - Cell Biology 2021Quote: B16-F1 murine melanoma cells (ATCC CRL-6323) were cultured in DMEM (4.5 g/L glucose, Invitrogen), supplemented with 10% FCS (Gibco ...
-
bioRxiv - Biophysics 2021Quote: ... B16-F1 cells (gift from Klemens Rottner, Technische Universität Braunschweig, Germany) were cultured in DMEM (ThermoFisher Scientific, 41966-029) supplemented with 10% fetal bovine serum (PAA Laboratories ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1976) from the F1 individuals and qualification and quantification of DNA were performed with NanoDrop One spectrophotometer (Thermo Scientific). On the F2 and F3 samples a rapid Chelex100-based procedure (Walsh et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... and 25 CD45.1+CD45.2+ HSCs from WT F1 mice were sorted into a 96-well plate with Ham’s F12 media containing 1X pen/strep/glutamine (Gibco), 10 mmol/l HEPES (Gibco) ...
-
bioRxiv - Genetics 2022Quote: ... The blasticidin resistance gene coding sequence was amplified by PCR with the primers BlasS SacII F1 and BlasS BamHI R3 from pcDNA6/V5-His-A (Invitrogen):
-
bioRxiv - Neuroscience 2022Quote: ... 376-bp product amplified by PCR using the Exon5-F1 and Exon5-RC1 primer pair was cloned into TOPO-TA vector (Invitrogen), and plasmids were sent for sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... the 376-bp amplicon containing Drd2-exon5 and introns/exon 5 junctions from several F0 and F1 mice were cloned into TOPO-TA Cloning vector (Invitrogen by Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... the F1 were screened by PCR for the rec-1 deletion at the expected site using an HpaII restriction enzyme (Thermofisher). PCR products harboring a deletion were Sanger sequenced at Eurofins ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 10-μL plasmid mixtures were mixed with 1 million B6/CAST F1-hybrid Rosa26-RMCE ESCs (in 100 μL Neon Buffer R) and electroporated using a Neon Transfection System (Invitrogen) with one 40-ms pulse of 1000 V before seeding sparsely onto a confluent 10-cm dish of gamma-irradiated drug-resistant (DR4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The A1 mouse ES WT and Nsd1-KO lines 73 (background C57BL/6 × 129S4/ SvJae F1) were obtained from David Allis lab and maintained on gelatin-coated plates in Knockout DMEM (Gibco) supplemented with 15% ES-cell-qualified FBS (Gemini) ...
-
Mechanisms of transcriptional regulation in Anopheles gambiae revealed by allele specific expressionbioRxiv - Genetics 2023Quote: RNA was extracted from pools of 10 female F1 progeny from each of the six crosses 3-5 days after eclosion using RNAqueous4PCR total RNA isolation kit (Invitrogen). RNA quality and quantity was checked to be adequate for library preparation using the Agilent Bioanalyser profile and Qubit® 2.0 Fluorometer ...
-
bioRxiv - Bioengineering 2021Quote: Ovaries from 6 to 8 day-old CBA × C57BL/6 (F1) mice were collected and transferred to Leibovitz L-15 media (P/N 11415, Gibco, USA). The ovaries were dissected into 2–4 pieces and transferred into maintenance media (α-MEM ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Total RNA was isolated from a composite sample of 10 individual F0 or F1 flies (five males and five females) by use of an RNA extraction kit (Thermo scientific), then cDNA was synthesized from RNA extracts according to the manufacturer’s protocol (see Al Naggar et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... 300ng or 500ng of RNA was reverse transcribed using the LK-F1 primer (SuperScript III First-Strand Synthesis System, Life Technologies), followed by a one round PCR using LK primer and a R1 primer (with manual hot start and touchdown PCR protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... EBs were cultured in F1 neural induction medium containing DMEM/F12 supplemented with 20% KnockOut Serum Replacement (Thermo Fisher Scientific, 10828028), 1X Penicillin-Streptomycin ...
-
bioRxiv - Cell Biology 2019Quote: ... The genomic DNAs from wild-type B16-F1 and twinfilin knockout cells were extracted with Genomic DNA extraction kit (Invitrogen, #K1820-00) and exon 3 regions were sequenced with twinfilin-1 specific primers 5’-AAGACTGCCGCTTCTAACCC and 5’-GAGTTGAGACCTACGTCACTC ...
-
bioRxiv - Developmental Biology 2022Quote: Two-layered secondary follicles were mechanically isolated from 12-day-old female F1 hybrids (C57BL/6J×DBA/2J) by using insulin-gauge needles in L15 media (Invitrogen, Carlsbad, CA) containing 1% fetal calf serum (FCS)41 ...
-
bioRxiv - Systems Biology 2019Quote: ... hybrid mESC line F1-21.6 (129Sv-Cast/EiJ) conditioned to LN511/Std condition were dissociated with 1× Trypsin (Thermo Fisher Scientific, Rochester, NY) with 1 mM EDTA at 37 °C for 3 min ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA was extracted from pools of 20-50 flash frozen full F1 brothers descending from a single cross using the PureLink RNA purification kit with DNase I digestion (Thermo Fisher Scientific, USA). TruSeq stranded mRNA-seq libraries (350 bp insert size ...
-
bioRxiv - Neuroscience 2022Quote: ... the 376-bp amplicon containing Drd2-exon5 and introns/exon 5 junctions from several F0 and F1 mice were cloned into TOPO-TA Cloning vector (Invitrogen by Thermo Fisher Scientific; Waltham, MA) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from BALB/cByJ x C57BL/6J F1 hybrid dissected spleens (n = 4) preserved in RNA later (Thermofisher, Cat. No. AM7020; Waltham, MA, USA). Briefly ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... egg sacs were removed from F1 gravid females using a fine needle and placed individually in wells of Falcon® 6-well plates (Thermo Fisher Scientific, Waltham, MA, USA). This was done for 10 SDxSC and 10 SCxSD egg sacs ...
-
bioRxiv - Genetics 2022Quote: ... approximately 470 base pairs surrounding the predicted dmiR-1-target site in 3’UTR of Mp were amplified directly from genomic DNA from the w1118 flies using the primers Mp-F1: ATAACTAGTTGAGCGGAAACGGAAGGAAGAAGAGGAG and Mp-R1: ATATCTAGATGTTGTGAATGATGACGTTAGG and a high-fidelity DNA Polymerase enzyme (Thermo Scientific Phusion High-Fidelity DNA Polymerase) kit ...
-
bioRxiv - Immunology 2023Quote: ... mouse anti-mouse PCSK9 (Invitrogen), mouse anti-mouse vinculin (Santa Cruz) ...
-
bioRxiv - Physiology 2024Quote: ... and TaqMan primers (mouse Panx1 mm0045091, mouse Panx2 mm01308054, mouse Pan×3 mm00552586, mouse Gja1 mm00439105, mouse Gja5 mm00433619– Invitrogen) (Rat Panx1 Rn01447976_m1 – Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2021Quote: ... mouse anti-mouse GAPDH (Thermo Fisher, #AM4300), rabbit-anti-mouse LSD1 (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were blocked for one hour with mouse-on-mouse blocking reagent (ReadyProbes™ Mouse-on-Mouse IgG Blocking Reagent, 1:30 dilution, ThermoFisher, R37621) between antibody staining procedures.
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-V5 mouse (Invitrogen, # R960-25, 1/1000), mouse anti-FLAG (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... PE-Cy5-conjugated mouse anti-mouse CD45.1 (A20; Thermofisher), PE-Cy5 or PE-CF594-conjugated rat anti-mouse CD45R/B220 (RA3-6B2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections stained with mouse primary antibodies were blocked in ReadyProbes “Mouse on Mouse” IgG blocking solution (Thermofisher) for 1 hour before the initial blocking step ...
-
bioRxiv - Pathology 2024Quote: ... HT7 was the only anti-mouse antibody used and a mouse-on-mouse blocking agent (Invitrogen: R37621) was applied for 30 minutes post protein block washes to reduce noise from secondary antibody binding and an additional three 5-minute washes were added before primary antibody incubation ...
-
bioRxiv - Immunology 2021Quote: ... anti-mouse IgM-HRP and anti-mouse IgA-HRP (ThermoFisher), goat anti-mouse Igκ ...
-
bioRxiv - Plant Biology 2024Quote: Mouse liver microsomes (purchased from Thermo: GIBCO Mouse (CD-1) Microsomes ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mm00440280_g1 (mouse, ThermoFisher), and TaqMan™ Universal Master Mix II ...
-
bioRxiv - Genomics 2019Quote: ... α-mouse (Invitrogen #A31570), α-goat (Invitrogen #A21432) ...
-
bioRxiv - Neuroscience 2021Quote: ... Mouse laminin (Gibco) was then added and incubated at 37°C for 4 hours ...