Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Resistant Starch Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and 0.1% starch (ThermoFisher). Solid and liquid cultivation was conducted at 37°C in an AS-580 anaerobic chamber (Anaerobe Systems ...
-
bioRxiv - Microbiology 2022Quote: ... The culture was pelleted at 4000 rpm for 2 min and resuspended in fresh LB containing 1% of the “DQ starch substrate stock solution” (1 mg/ml, EnzChek Ultra Amylase Assay Kit, Invitrogen Detection Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... Soluble starch was purchased from Affymetrix, Santa Clara ...
-
bioRxiv - Microbiology 2022Quote: ... 1 g/L soluble starch (ThermoFisher), 4 g/L K2HPO4 ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein concentrations in samples were measured using a Detergent Resistant Bradford Assay (ThermoFisher). Samples were prepared for SDS-PAGE in 6x Laemmli buffer and denatured for 5 minutes at 95 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein concentration was determined using a microplate and BCA assay kit (Thermofisher) as per manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2022Quote: ... meliloti Sm1021 resistant mutants using GeneJET Genomic DNA purification kit (ThermoFisher) according to the manufacturer protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... Protein content was estimated (Microplate BCA protein assay Kit-reducing agent compatible, Thermo Scientific) with bovine serum albumin as the standard ...
-
bioRxiv - Neuroscience 2023Quote: ... and ventral hippocampus were quantified using a Pierce Microplate BCA Protein Assay Kit (Thermo Scientific Pierce Protein Biology ...
-
bioRxiv - Bioengineering 2024Quote: ... Protein concentrations were measured using a Microplate BCA Protein Assay Kit (Thermo Scientific; Waltham, MA) to determine load volumes for 5µg of total protein ...
-
bioRxiv - Microbiology 2021Quote: ... Total protein content was determined by the Lowry method (77) adapted to a 96-well plate assay with the Microplate BCA Protein Assay Kit (23252, Thermo Scientific), using bovine serum albumin (BSA ...
-
bioRxiv - Neuroscience 2022Quote: ... and protein concentration for each sample was determined using a BCA assay (Pierce Microplate BCA Protein Assay Kit, ThermoFisher, Waltham, MA). Equal amounts of protein were prepared using 4x NuPage sample buffer (Thermo Fisher ...
-
bioRxiv - Genomics 2019Quote: ... Ampicillin resistant colonies were collected and extracted for plasmids using Maxiprep kit (Invitrogen). Ten sampling clones from the agar plate were analyzed by PCR and Sanger sequencing to verify successful cassette insertion and barcode diversity (Primer details in Table S1).
-
bioRxiv - Systems Biology 2019Quote: ... Protein concentration was quantified using the Pierce Microplate BCA Assay Kit (Cat No. 23252 Thermo Fisher). Samples were prepared with 10x Bolt Sample Reducing Agent (Cat No ...
-
bioRxiv - Cancer Biology 2024Quote: ... MR42D and MR49F (hormone resistant, treatment resistant) cells were cultured in RPMI 1640 medium (Life Technologies), supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2022Quote: ... NJ) in pcDNA3.1(-) (hygromycin-resistant; Invitrogen) by insertion of the nucleotide sequence GATTACAAGGATGACGACGATAAG ...
-
bioRxiv - Neuroscience 2020Quote: CO2 resistant Orbital Shakers (ThermoFisher, #88881102)
-
bioRxiv - Microbiology 2021Quote: ... and ceftriaxone-resistant (Brilliance ESBL, ThermoFisher) Enterobacteriacae colonies ...
-
bioRxiv - Genetics 2022Quote: ... EdU incorporation was quantified using the Click-iT™ EdU Proliferation Assay for Microplates kit (Invitrogen, C10499) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... Protein concentration was quantified using the Microplate Procedure with the Pierce BCA Protein Assay Kit (Thermo Scientific) according to the manufacturer’s instructions and used to calculate the concentration of the samples ...
-
bioRxiv - Microbiology 2021Quote: ... Protein concentrations were determined in parallel using a Pierce®Microplate BCA Protein Assay Kit (Thermo Scientific).
-
bioRxiv - Immunology 2024Quote: ... plates (Corning 96 Well EIA/RIA Assay Microplate, ThermoFisher #3369) were coated with goat anti-hIgG(H+L ...
-
bioRxiv - Genetics 2020Quote: ... ccdB resistant chemically competent E.coli (Invitrogen, A10460) were transformed with plasmids containing a Gateway cassette (ccdB ...
-
bioRxiv - Molecular Biology 2021Quote: ... The total protein concentration was measured using a Microplate BCA Protein Assay Kit (Pierce™, Thermo Fisher Scientific). Proteins were separated on an SDS-PAGE gel and then transferred to a nitrocellulose (NC ...
-
bioRxiv - Neuroscience 2023Quote: Total protein levels in cortex homogenates were quantified using a Pierce Microplate BCA Protein Assay Kit (Thermo Scientific Pierce Protein Biology ...
-
CREB5 reprograms nuclear interactions to promote resistance to androgen receptor targeting therapiesbioRxiv - Cancer Biology 2021Quote: ... Blasticidin-resistant Cas9-positive LNCaP enzalutamide resistant cells were cultured in 10 μg/ml blasticidin (Thermo Fisher Scientific, NC9016621) for 72 h to select for cells with optimal Cas9 activity ...
-
bioRxiv - Microbiology 2020Quote: ... 10 ng of clarified cell lysate (calculated using Pierce Microplate BCA Protein Assay Kit - Reducing Agent Compatible, ThermoFisher Scientific) was incubated with 1 ng of digoxigenin-labelled m67 probe (double-stranded ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total protein was measured using Pierce BCA Protein Assay Kit according to the manufacturer’s microplate protocol (Thermo Fisher 23225). A final concentration of 1X Laemmli sample buffer (Bio-Rad 161-0747 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total protein was measured using Pierce BCA Protein Assay Kit according to the manufacture’s microplate protocol (Thermo Fisher 23225). 1X Laemmli sample buffer (Bio-Rad 161-0747 ...
-
bioRxiv - Biochemistry 2022Quote: ... gentamycin-resistant colonies was prepared by midiprep (Thermofisher) and the insert verified by sequencing ...
-
bioRxiv - Neuroscience 2020Quote: Total protein levels were quantified in tissue homogenates using the Pierce Microplate BCA Protein Assay Kit in triplicates following the manufacturer’s protocol (Thermo Scientific Pierce Protein Biology ...
-
bioRxiv - Neuroscience 2023Quote: ... Total protein levels were quantified using a Pierce™ Microplate BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA). A total of 30 μg protein was separated by SDS-PAGE at 200 V for 45 min using a 4%–12% precast polyacrylamide gel (Novex ...
-
bioRxiv - Microbiology 2023Quote: ... and a Microplate Reader SH-9000Lab (Corona Electric, Hitachinaka, Ibaraki, Japan) with a Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen) following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: Of the 270 HGSOC subjects classified as sensitive or resistant to chemotherapy, 238 (138 sensitive, 100 resistant) had microarray expression data available (Affymetrix ht_hg_u133a chip) in the GDC portal ...
-
bioRxiv - Genetics 2019Quote: ... transformed into OneShot OmniMax 2T1 Phage-Resistant Cells (Invitrogen), and plasmid was purified from overnight culture.
-
bioRxiv - Genomics 2022Quote: ... 1 μl Exo-Resistant random primer (Thermo Fisher Scientific) and 3 μl lysis buffer (400 mM KOH ...
-
bioRxiv - Genomics 2020Quote: ... the protein concentration of lysates was first determined using the Microplate BCA protein assay kit – reducing agent compatible (Thermo Fisher Scientific), according to the manufacturer’s instruction ...
-
bioRxiv - Genetics 2020Quote: ... Protein concentration was measured by reducing-agent compatible microplate BCA Assay (Thermo Scientific) according to kit protocol ...
-
bioRxiv - Physiology 2022Quote: ... Total protein in an average 11 µL supernatant was estimated by the Pierce BCA assay following the manufacturer’s protocol for microplate assay (Thermofisher). An average of 6.1 µg (S.D ...
-
bioRxiv - Developmental Biology 2021Quote: Human PSCs resistant to neomycin were incubated with Accutase (Gibco) in 37°C for 5-10 minutes ...
-
bioRxiv - Pathology 2021Quote: ... coli competent cells (AMP resistant) (Thermo Fisher Scientific, Waltham, Ma). RNA PCR was performed using T7 ...
-
bioRxiv - Neuroscience 2022Quote: ... Puromycin resistant cells were selected with 1µg/ml puromycin (Gibco).
-
bioRxiv - Cell Biology 2023Quote: ... and the clones resistant to puromycin (A11138-03, Life Technologies) were selected ...
-
bioRxiv - Neuroscience 2023Quote: ... and cultured under orbital agitation (Thermofisher CO2 resistant orbital shaker). The subsequent media changes of the Chimeroids followed our published protocol changing to CDM3 media at DIV35 ...
-
bioRxiv - Genomics 2024Quote: ... 1 μl of exo-resistant RND primers 500 μM (ThermoFisher) are added ...
-
bioRxiv - Microbiology 2021Quote: ... followed by collection of supernatants for quantification of total protein concentration using Microplate BCA Protein Assay Kit (Pierce™, Thermo Fisher Scientific). Equal amounts of protein were separated by SDS-PAGE using 4-15% SDS polyacrylamide gels (Bio-Rad) ...
-
bioRxiv - Cell Biology 2022Quote: ... supernatant was used for analysis with GLP-1, Active form Assay Kit (Immuno-Biological Laboratories, Gunma, Japan) and microplate reader (Varioskan LUX, Thermo Fisher Scientific).
-
bioRxiv - Immunology 2022Quote: ... Lysates were transferred to 96-well black microplates suitable for fluorescent based assays (Invitrogen). Each well contained lysates of 1 Mio cells ...
-
bioRxiv - Cancer Biology 2024Quote: Turbidity assays were performed in a Varioskan Lux 3020-81205 Microplate Reader (Thermo Scientific). P53C ...
-
bioRxiv - Biochemistry 2021Quote: The ATPase activity of WT SidJ and its mutants was measured in a UV-transparent microplate using the EnzChek Pyrophosphate Assay Kit (ThermoFisher Scientific, E-6645). The assay was performed in triplicates ...