Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Recombinant Human Ribulose 5 Phosphate 3 Epimerase His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: Recombinant His-tagged EB1-GFP and His-tagged SEPT5 were transformed into E.coli BL21 (DE3) (Invitrogen). Bacterial cultures were grown to OD600 of 0.6-0.8 and induced with 0.2 mM IPTG for 16 h at 18°C for His-tagged-EB1-GFP or cultures were grown to OD600 of 0.4-0.6 and induced with 1 mM IPTG for 5 h at 23°C for His-tagged SEPT5 ...
-
bioRxiv - Molecular Biology 2020Quote: Recombinant 6x-His tagged PTB was purified using Ni-NTA agarose (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Purified recombinant human p38α (MAPK14, GST-tagged, Thermo Fisher Scientific, #PV3304), p38β (MAPK11 ...
-
bioRxiv - Cell Biology 2022Quote: ... the recombinant GST-tagged kinase active human mTOR (Cat. PV4753, ThermoFisher) was used instead of the immunoprecitated mTORC1 ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids encoding for recombinant His-tagged proteins were transformed into Escherichia coli BL21(DE3) (Invitrogen). Bacterial cultures were grown at 37°C in LB media to OD600 of 0.6-0.8 and induced with 0.5 mM IPTG at 18 °C for 16h (overnight) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 ng/mL recombinant human GDNF (Gibco), and 5 μM TRO19622 (Tocris) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 10ng/ml recombinant human IL-3 (Gibco). Cultured cells were infected with lentivirus encoding GFP/Scrambled control shRNA overnight and fresh media was added the following day ...
-
bioRxiv - Microbiology 2023Quote: His-tagged recombinant full-length SdeC derivatives were adsorbed to Ni-NTA (Thermo Fisher Scientific, Cat# 88221) resin at 1μg enzyme per 25 μl of packed resin in 1X ART buffer for 1 hr at 4°C with end-over-end rotation ...
-
bioRxiv - Microbiology 2023Quote: His-tagged recombinant SdeC and its derivatives were bound to Ni-NTA (Thermo Fisher Scientific, Cat# 88221) resin at 1 μg enzyme per 25μl of packed resin in 1X ART buffer (20mM Tris 10mM NaCl ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg/mL human recombinant insulin (Thermo Fisher), and 1 μg/mL hydrocortisone (Sigma Aldrich) ...
-
bioRxiv - Immunology 2022Quote: ... human recombinant Annexin V (5 μg/ml) (Invitrogen, #BMS306) or with the same amounts of their respective solvent (DMSO or H2O ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Neuroscience 2024Quote: ... After blocking supernatant samples from different groups and standards (recombinant human-TREM2-His; Life Technologies) were incubated for 2 h at room temperature (RT ...
-
bioRxiv - Biochemistry 2020Quote: ... 6x-His-tagged constructs of human and murine SNED1 cloned into pCDNA5/FRT (Thermo Fisher, Waltham, MA) between the FseI and AscI sites were used to transiently transfect 293T cells to validate the anti-SNED1 antibody generated in this study (Supplementary Figure S1) ...
-
bioRxiv - Cell Biology 2019Quote: ... p38β (MAPK11, His-tagged, Thermo Fisher Scientific, #PV3679), p38γ (MAPK12 ...
-
bioRxiv - Cell Biology 2019Quote: ... p38γ (MAPK12, His-tagged Thermo Fisher Scientific, #PV3654), p38d (MAPK13 ...
-
bioRxiv - Cell Biology 2019Quote: ... p38d (MAPK13, His-tagged, Thermo Fisher Scientific, #PV3656) and hPI31 (UBPBio ...
-
bioRxiv - Immunology 2023Quote: ... 6x His Tagged monoclonal antibody (Thermo Fisher Scientific) was also plated as an experimental control ...
-
bioRxiv - Microbiology 2021Quote: ELISA assays were performed in 96-microwell plates coated with 150 ng/well of SARS-CoV-2 Spike (aa 16-1213) His-tagged recombinant protein (ThermoFisher) and 1010 phage or AAVP particles/50 μL of PBS O.N ...
-
bioRxiv - Immunology 2021Quote: ... The proteins were then purified by immobilized metal affinity chromatography by using HisPur Ni-NTA (Purify His-tagged recombinant fusion proteins using high-capacity nickel-nitrolotriacetic acid methal-chelate beads) spin columns (ThermoFisher). Recombinant proteins were refolded on the column by gradually removing urea until reaching to a concentration 0 M and then dialyzed against PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... recombinant His-tagged Endocan (R&D) was immobilized on 50 μl of HisPur Ni-NTA Magnetic Beads (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: Recombinant His-tagged Endocan (R&D) was immobilized on 50 μl of HisPur Ni-NTA Magnetic Beads (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... human recombinant Epidermal Growth Factor (5 ng/ml, ThermoFisher Scientific) and 0.15 mM CaCl₂ (Sigma-Aldrich) ...
-
bioRxiv - Physiology 2022Quote: ... and 5 ng/mL recombinant human EGF (Gibco Cat# PHG0311). Once IPEC-J2 reached confluence ...
-
bioRxiv - Cell Biology 2019Quote: ... 10 μg of purified GST-MKLP1620-858 proteins (wild type and AQA mutant) bound to beads were phosphorylated in vitro with 2 μg of recombinant His-tagged Aurora B (Thermo Fisher) as described10,27 and then washed three times with 500 μl of phosphatase buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 293 cells were transfected with plasmids encoding His-tagged recombinant proteins as described in the Plasmids section using lipofectamine 2000 (Invitrogen, #11668019) following the manufacturer’s instructions (four 100 mm plates each plasmid) ...
-
bioRxiv - Biochemistry 2022Quote: ... His-tagged CDC50A was detected using a His-probeTM -HRP from Thermo Scientific (15165). Precast stain-free gradient gels for tryptophan fluorescence (4568084 ...
-
bioRxiv - Immunology 2019Quote: ... supplemented with 5 ng/mL recombinant human interleukin 2 (Gibco, #PHC0027), 2 mM L-glutamine (Lonza ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Cell Biology 2021Quote: Purified recombinant GST-tagged CDK1-cyclin A2 and His6-tagged CDK1-cyclin B1 (Invitrogen) were stored in 150 mM NaCl ...
-
bioRxiv - Systems Biology 2020Quote: ... the GST-Tagged proteins were eluted with 15 mM GSH (Bio-basic) and cleaved in solution using purified recombinant His-Tagged TEV protease (Thermo Fisher Scientific). Tag-free NCK2 proteins were further purified using a 1 ml HisTrap FF column (GE Healthcare ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg of FGFb Recombinant Human Protein and 1% Gluta-MaxTM (Gibco) in flasks coated with Matrigel Matrix Basement Membrane (Corning ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng/mL human recombinant GM-CSF (Thermo Fisher Scientific, USA) at 37 °C and 5 % carbon dioxide ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng/mL human recombinant GM-CSF (Thermo Fisher Scientific, USA). The incubator condition was set at 37 °C with 5 % carbon dioxide environment ...
-
bioRxiv - Biochemistry 2024Quote: ... The recombinant SARS-CoV-2 Spike S1-hFc-His tagged protein used for titrations and sorting was purchased from ThermoFisher (RP-876-79). The recombinant neuraminidase (NA ...
-
bioRxiv - Plant Biology 2022Quote: ... His-tagged ChElp2 was pulled-down with Dynabeads™ His-Tag (Thermo Fisher Scientific, Massachusetts, USA) and the subsequent western blot analyses were performed with anti-His (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... the lysate supernatant containing His-tagged proteins was affinity-purified with His-Tag magnetic beads (Invitrogen) and used for pull-down assays ...
-
bioRxiv - Molecular Biology 2022Quote: ... zipper tag via a 5XGGS linker region was co-transfected with N-terminally His-tagged human Leptin in suspension HEK293 FreeStyle cells (ThermoFisher) in the presence of 20 μM kifunensine (Dextra ...
-
bioRxiv - Microbiology 2020Quote: ... His tagged proteins were isolated from the supernatant using Dynabeads™ His-Tag Isolation and Pulldown (Invitrogen) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The His-tagged proteins were blotted using anti-6x His tag HRP-conjugated monoclonal antibody (Invitrogen, USA) and detected using Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Neuroscience 2021Quote: His-tagged human dynamin 1 was expressed using the Bac-to-Bac baculovirus expression system (Thermo Fisher Scientific, Waltham, MA, USA) and purified as described previously (66) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... for His-tagged proteins or GST-agarose resin (Thermo Fisher Scientific) for GST-tagged proteins ...
-
bioRxiv - Microbiology 2021Quote: ... Indicated amounts of recombinant GFP-His (Thermo Fisher # A42613) or SARS-CoV-2 N-His (Sino Biological # 40588-V08B ...
-
bioRxiv - Microbiology 2023Quote: ... Indicated amounts of recombinant GFP-His (Thermo Fisher # A42613) or HCoV-OC43 N-His (Sino Biological # 40643-V07E ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2023Quote: ... mammalian expression constructs carrying C-terminal 6X-His tagged gene of interest (HpARI1-3, or ST2 ectodomain) were transfected individually into Expi293F cells (Thermo Fisher) using the Expifectamine transfection kit (Thermo Fisher) ...