Labshake search
Citations for Thermo Fisher :
1 - 50 of 4779 citations for PLK1 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... PLK1 (Silencer Select siRNA #1, Ambion) as positive control ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-PLK1 (Thermofisher 33-1700), rabbit anti-TTBK2 (Sigma HPA018113) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PLK1 (1:500, mouse, Thermo Fisher # 33-1700), Ubiquitin FK2 (1:1,000 ...
-
bioRxiv - Immunology 2021Quote: Sorted HSC were also cultured with blocking CD150 peptide (FCKQLKLYEQVSPPE, Auspep, 100 μg/ml) or control peptide (DLSKGSYPDHLEDGY, Auspep,100 μg/ml) (Thermo Scientific).
-
bioRxiv - Cell Biology 2022Quote: ... PLK1 mRNAs were transcribed in vitro using a T3 mMESSAGE mMACHINE (Ambion) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Immunopurified PLK1 was resolved on 4-12% Bis-Tris precast mini gels (Life Technologies). Following electrophoresis ...
-
bioRxiv - Cell Biology 2020Quote: ... For the knock down of Plk1 small interfering RNA (siRNA) duplexes AACGAGCTGCTTAATGACGAGTT were used (ThermoFisher). For Astrin siRNA oligo #367 (5′-TCCCGACAAC TCACAGAGAAA -3′)(Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... PLK1 siRNA (s449) or non-targeting control (NT) siRNA (AM4636) was purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: Full-length PLK1 and PLK2 sequences were PCR amplified and individually cloned into pCDNA3.1 vector (Invitrogen) using XbaI-EcoRI and XbaI-BamHI (New England BioLabs ...
-
bioRxiv - Developmental Biology 2021Quote: ... After blocking with blocking buffers (Thermo Scientific) for 30 minutes ...
-
bioRxiv - Immunology 2023Quote: ... for activated cells with human PLK1-specific siRNAs (#4390824, s448) and negative control siRNA (#4390846) (Invitrogen, Waltham, Massachusetts, USA) (150 ng/106 cells) ...
-
bioRxiv - Cell Biology 2022Quote: ... and then blocking in Superblock Blocking Buffer (Thermo Fisher Scientific). Subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... Blocking was performed using BlockAid Blocking Solution (Thermo Fisher Scientific). Primary antibody incubation against clathrin heavy chain (ab21679 from Abcam ...
-
bioRxiv - Molecular Biology 2022Quote: ... Blocking Buffer (Invitrogen Cat# 00-4952-54 ...
-
bioRxiv - Microbiology 2021Quote: ... and blocking in SuperBlock Blocking Buffer (Thermo Fisher Scientific, Waltham, MA). Cleaved caspase-3 was immunostained by incubating HAE with a primary human cleaved caspase-3 (Asp175 ...
-
bioRxiv - Cancer Biology 2019Quote: ... After blocking with SuperBlock T20 (PBS) Blocking Buffer (Thermo Fisher Scientific), the plates were incubated with culture supernatant with subsequent 1:2000 diluted peroxidase-conjugated anti-mouse IgG (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2023Quote: ... before blocking in SuperBlock™ blocking buffer (Thermo Fisher Scientific, 37515). Primary antibodies (MAP2 (1:1000 ...
-
bioRxiv - Microbiology 2023Quote: ... followed with endo-biotin blocking using a blocking kit (Invitrogen, #E21390) according to the manufacture instructions [118] ...
-
bioRxiv - Microbiology 2023Quote: ... blocking was performed overnight using SEA BLOCK Blocking buffer (ThermoFisher, 37527) at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... The peptide concentrations of eluted peptides were quantified using the Pierce Fluorometric Peptide Assay (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Peptides were quantified with Quantitative Colorimetric Peptide Assay (Thermo Scientific) and 5 µg of total peptides were labeled using TMTpro16-plex reagents (Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Peptides were desalted with peptide desalting spin columns (Thermo Scientific) and dried via vacuum centrifugation ...
-
bioRxiv - Cancer Biology 2022Quote: ... A 40-minute blocking step with Super Block Blocking buffer (Thermo Scientific) was performed prior to adding the primary antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... A 40-minute blocking step with Super Block Blocking buffer (Thermo Scientific) was performed prior to adding the primary antibody ...
-
bioRxiv - Cell Biology 2021Quote: In vitro protein kinase assay was carried out by incubation of 1 ug purified protein substrates in the presence or absence of 100 ng PLK1 (Thermo Fisher) or CDK1/cyclin B1 (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... They were individually transferred into either bait pB-CMV-CVn-neo (for PLK2) or prey pB-CMV-YFP-CC-puro (for RB1, TUBB, CHK1, PLK1) vectors using Gateway recombination reaction (Life Technologies) (76) ...
-
bioRxiv - Biochemistry 2023Quote: Peptide samples were assayed for peptide concentration with Pierce™ Quantitative Colorimetric Peptide Assay (Thermofisher Scientific, Brisbane, Australia), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Labelled peptides were quantified (Pierce Colorimetric Peptide Assay Kit, Thermo Scientific) and mixed 1:1:1 based on peptide amount.
-
bioRxiv - Molecular Biology 2023Quote: ... Peptides were quantified using a colorimetric peptide assay (Thermo Fisher Scientifc). Peptides (1 µg ...
-
bioRxiv - Cell Biology 2024Quote: Peptide concentration was determined using colourimetric peptide assay (Thermo Fisher Scientific). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: Peptide concentration was determined using a colorimetric peptide assay (ThermoFisher Scientific). All samples were reconstituted in loading buffer (5% CH3CN ...
-
bioRxiv - Biophysics 2021Quote: ... blocking of endogenous biotin was performed using a commercial blocking kit (Invitrogen, E21390). Cells were incubated in component A for 45 minutes ...
-
bioRxiv - Developmental Biology 2019Quote: ... After blocking with 10% goat serum or Superblock blocking buffer (Thermo Fisher Scientific) for 30 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... The blot was blocked for 1 h with 5% skimmed milk and the membrane was probed with anti-PLK1 primary monoclonal antibody (Invitrogen: 37-7000), anti-BCL2 primary monoclonal antibody (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... Peptide digest assay standard (PierceTM Quantitative Colorimetric Peptide Assay, Thermo Scientific, USA) was as standard for quantitative analysis of peptides ...
-
bioRxiv - Cell Biology 2022Quote: ... peptide concentration was measured using a colorimetric peptide quantification assay (Thermo Scientific). Finally ...
-
bioRxiv - Systems Biology 2019Quote: ... Peptides were quantified using Pierce Quantitative Fluorometric Peptide Assay (Thermo Fisher Scientific) according to manufacturer’s instructions on a Varioskan LUX Multimode Microplate Reader and SkanIt 5.0 software (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... Peptide concentration was determined by a quantitative colorimetric peptide assay (Thermo Fisher), and 1 μg aliquots of clean peptides from each sample were injected sequentially over a nano-flow C18 column (EasySpray ...
-
bioRxiv - Cell Biology 2022Quote: ... Peptide concentrations were determined using Pierce Quantitative Fluorometric Peptide Assay (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... peptides were desalted on PierceTM Peptide Desalting Spin Columns (Thermo Fisher Scientific) and concentrated in a SpeedVac concentrator.
-
bioRxiv - Microbiology 2021Quote: ... The peptide digests were then cleaned up using peptide desalting columns (ThermoFisher) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... After washing with PBS-T and blocking with StartingBlock (TBS) blocking buffer (ThermoFisher Scientific), serially diluted serum from groups of immunized mice or baboons were added to coated wells and incubated for 1 hour at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... followed by blocking with Starting Block T20 blocking buffer (Thermo Fisher Scientific catalog #37539) for 13 minutes ...
-
Pan-tissue mitochondrial phenotyping reveals lower OXPHOS expression and function across tumor typesbioRxiv - Biochemistry 2023Quote: ... following peptide quantification (ThermoFisher). All samples were subjected to nanoLC-MS/MS analysis using an UltiMate 3000 RSLCnano system (Thermo Fisher ...
-
bioRxiv - Genomics 2023Quote: Custom peptides (ThermoFisher Scientific) with the sequence N-CAIHAK115RVTIMPK-C were synthesized as unmodified (H3K115) ...
-
bioRxiv - Immunology 2022Quote: ... Casein blocking buffer (Thermo Scientific) was then added and the cells were incubated for 60 to 90 minutes at 37 °C in 10% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... SEA blocking buffer (Thermo Scientific) and 1% BSA in PBS in the subsequent panning rounds ...
-
bioRxiv - Plant Biology 2020Quote: ... Tryptic peptide samples were quantified by a colorimetric peptide assay (Pierce, Thermo Fisher) and aliquots of 200 ng were injected by LC-MS/MS ...
-
bioRxiv - Developmental Biology 2020Quote: ... peptide concentrations were quantitated by the Pierce Quantitative Colorimetric Peptide Assay (Thermo Fisher).
-
bioRxiv - Bioengineering 2020Quote: ... Peptide concentration was determined with the Pierce Peptide Quantitation Kit (Thermo Fisher Scientific) and all samples were normalized to 0.1 g/L in 100 μL total volume ...