Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Mouse Eukaryotic Translation Initiation Factor 4E Binding Protein 1 EIF4EBP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and the murine housekeeping gene eukaryotic translation elongation factor-1α (EF1a; assay ID: VB1-14428-VT, Affymetrix, Inc.), that shares 95% sequence identity with the Syrian hamster ...
-
bioRxiv - Cancer Biology 2023Quote: ... with the Mouse Monocyte Chemoattractant Protein-1/CCL2 (MCP-1) Uncoated ELISA Kit (ThermoFisher) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... in vitro synthesized guide RNA (sgRNAs) that were designed to cut shortly after the translation initiation codon in Ajuba Exon 1 were ordered from ThermoFisher’s sgRNA service (CCGGAGTCCGAGAGTCTCAACTT) ...
-
bioRxiv - Immunology 2021Quote: Maxisorp high protein binding 96 well ELISA plate (Nunc, Thermo Fisher Scientific.) was coated with 2μg/mL goat anti-human Fc antibody (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: Maxisorp high protein binding 96 well ELISA plate (Nunc, Thermo Fisher Scientific.) was coated with 2μg/mL goat anti-human Fc antibody (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... Mouse α-TATA Binding Protein (ThermoFisher 49-1036), Goat α-mouse:HRP (Novus Biologicals NBP2-31347H) ...
-
bioRxiv - Microbiology 2022Quote: ... High-binding ELISA plates (Thermo Scientific) were coated with capture antibody and incubated overnight at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... MaxiSorp high binding ELISA plates (Nunc) were coated with 100 μL/well of 1 μg/mL recombinant SARS-CoV-2 protein in PBS ...
-
bioRxiv - Immunology 2021Quote: ... MaxiSorp high binding ELISA plates (Nunc) were coated with 100 μL per well of 1 μg mL−1 recombinant SARS-CoV-2 protein with the pre-fusion stabilized conformation in PBS ...
-
bioRxiv - Immunology 2022Quote: ... MaxiSorp high-binding ELISA plates (NUNC) were coated with 10μg/mL Spike protein in PBS (50mL per well) ...
-
bioRxiv - Biochemistry 2023Quote: ... MaxiSorp high binding ELISA plates (Nunc) were coated with 100□μl/well of 1□μg/ml highly purified SARS-CoV-2 SARS-CoV-2 RBDs ...
-
bioRxiv - Immunology 2019Quote: ... IL-1 alpha Mouse Uncoated ELISA Kit (ThermoFisher #88-501988); eBioscience Mouse IL-6 ELISA Ready-SET-Go! Kit (Fisher Scientific #50-112-8863 ...
-
bioRxiv - Immunology 2020Quote: ... The following ELISA kits were used: IL-1β Mouse ELISA kit (ThermoFisher), IL-18 Mouse ELISA kit (ThermoFisher) ...
-
bioRxiv - Immunology 2022Quote: ... IgA mouse uncoated ELISA kit (ThermoFisher) was used following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... IL-18 Mouse ELISA kit (ThermoFisher), and ELISA MAX Deluxe Set Mouse TNFα (Biolegend) ...
-
bioRxiv - Cancer Biology 2021Quote: Hypoxia-inducible factor 1-alpha (HIF-1α) was evaluated using a HIF-1 Alpha ELISA Kit (Invitrogen™). Procedure steps were followed according to the manufacturer’s instructions and results were monitored at 450 nm using a microplate reader (iMARK™ ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse IL21 protein levels in BM supernatant were determined using an IL21 Mouse ELISA kit (ThermoFisher Scientific).
-
bioRxiv - Immunology 2022Quote: ... High-binding 96-well ELISA plates (Nunc) were coated with anti-mouse IL-10 (eBioscience ...
-
bioRxiv - Microbiology 2020Quote: High-binding 96-well ELISA plates (Nunc) were coated with 0.5 µg/well of purified SARS-CoV-2 N protein in carbonate/bicarbonate buffer 0.05 M pH 9.6 and allowed to bind over night at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... and supplemented 1:2000 with Neuron Growth Factor (Ngf 2.5S Native Mouse Protein, Invitrogen) in the right ...
-
bioRxiv - Bioengineering 2022Quote: mMCPT-1 was detected using the MCPT-1 mouse uncoated ELISA kit (ThermoFisher) following the protocol provided by manufacturer ...
-
bioRxiv - Cell Biology 2022Quote: Translation activity at the midbody was assessed by detecting protein synthesis level using an L-HPG-translation kit (ThermoFisher, Cat# C10429) as previously described 44 ...
-
bioRxiv - Microbiology 2023Quote: ... The high protein-binding capacity 96 well ELISA plate (Nunc MaxiSorp® flat-bottom, Invitrogen) was coated with ELISA capture antibody ...
-
bioRxiv - Microbiology 2023Quote: ... The high protein-binding capacity 96 well ELISA plate (Nunc MaxiSorp® flat-bottom, Invitrogen) was coated with ELISA capture antibody ...
-
bioRxiv - Plant Biology 2022Quote: The 5 kbp putative promoter fragment upstream of the translation initiation codon of each gene was cloned into pENTR4 dual-selection vector (Thermo Fisher SCIENTIFIC, USA) using an In-Fusion HD cloning kit ...
-
bioRxiv - Cancer Biology 2021Quote: The cell membrane protein samples were collected using Mem-PER eukaryotic membrane protein extraction reagent kit (Thermo Scientific, 89826, MA) according to the protocol instruction ...
-
bioRxiv - Immunology 2021Quote: ... IL-6 mouse ELISA kit (ThermoFisher Scientific) and IL-1β mouse ELISA kit (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... IL-6 Mouse ELISA kit (ThermoFisher, USA) was used ...
-
bioRxiv - Physiology 2024Quote: ... Initiation media contained 1% bovine serum albumin (Thermofisher™, B14) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The ELISA test was performed using IFNa Mouse ELISA Kit (Thermo Fisher) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2020Quote: Protein samples from in vitro translation experiments were quantified with a Qubit Protein Assay kit (Thermo Scientific), mixed with 6x SDS Laemmli reducing buffer (Alfa Aesar) ...
-
bioRxiv - Immunology 2019Quote: ... eBioscience Mouse IL-6 ELISA Ready-SET-Go! Kit (Fisher Scientific #50-112-8863; IL-1 beta Mouse Uncoated ELISA Kit (Thermo Fisher Scientific #88-7013-88).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Colorimetric protein assays were conducted using commercial human IL-8 ELISA and mouse IL-6 ELISA kits (Invitrogen; 88-8086, 88-7064) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... and IL-1β Mouse ELISA Kits (ThermoFisher Scientific), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and IL-1β mouse ELISA kit (ThermoFisher Scientific), following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse IL1β ELISA kits were purchased from ThermoFisher Scientific (Cat# 88-7013-22) ...
-
bioRxiv - Neuroscience 2023Quote: ... and IL-1RA Mouse ELISA Kit (Invitrogen, #EMIL1RN). Calculated protein concentrations were then normalized to starting tissue weight to generate values in pg/mg.
-
bioRxiv - Neuroscience 2023Quote: ... Mouse IL1β ELISA Kit (Thermo Fisher Scientific, BMS6002), Mouse IL10 ELISA Kit (R&D Systems ...
-
bioRxiv - Molecular Biology 2019Quote: ... for unperturbed samples or RiboMinus Eukaryotic Kit v2 (ThermoFisher, A15020) for PlaB/DMSO samples ...
-
bioRxiv - Immunology 2021Quote: ... IL-2 ELISA was performed using IL-2 Mouse Uncoated ELISA Kit (Invitrogen) following manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... and then subjected to measurement of IL-1β protein using the Mouse IL-1 beta-uncoated ELISA kit (Invitrogen, Waltham, MA), following manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... Kits used for ELISA were TGF-β1 Mouse ELISA Kit (Thermo Fisher Sci Cat. # BMS608-4TWO), Mouse Testosterone ELISA Kit (Crystal Chem ...
-
bioRxiv - Immunology 2023Quote: ... Plasma renin was measured using the Mouse Renin 1 (REN1) ELISA Kit (Invitrogen) and plasma ACTH was measured using Mouse/Rat ACTH SimpleStep ELISA® Kit (Abcam) ...
-
bioRxiv - Immunology 2024Quote: ... To enrich for MCL-1 binding protein immunoprecipitation was preformed using the Dynabeads Protein G IP Kit (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... TNF alpha mouse high sensitivity ELISA kit and IL-6 mouse high sensitivity ELISA kit were from Invitrogen (Thermo Fisher Scientific), mouse CCL2/JE/MCP-1 quantikine ELISA kit ...
-
bioRxiv - Immunology 2021Quote: High binding ELISA plates (07-200-37, Fisher Scientific) were coated with 1 μg/mL of labeled and blocked with 2% BSA in PBS ...
-
bioRxiv - Immunology 2021Quote: ... high binding ELISA plates (07-200-37, Fisher Scientific) were coated with 1 μg/mL trimer and blocked with 2% BSA in PBS ...
-
bioRxiv - Immunology 2022Quote: ... 96-well high-binding ELISA plates (Thermo Fisher Scientific) were coated overnight at 4 °C with 100 μL of 0.8 μg/mL (80 ng/well ...
-
bioRxiv - Immunology 2022Quote: ... 96–well high-binding ELISA plates (Thermo Fisher Scientific) were coated overnight at room temperature (RT ...
-
bioRxiv - Immunology 2023Quote: ... high-binding ELISA plates (07-200-37, Fisher Scientific) were coated with 1 mg/ml trimer and blocked with 2% BSA in PBS overnight ...