Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Mouse Anti Mycoplasma pneumoniae P1 6532 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... pneumoniae (Invitrogen) and rabbit anti-P ...
-
bioRxiv - Microbiology 2023Quote: ... pneumoniae (Thermo Fisher Scientific), ZO-1 (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-P1 (1:100, Istvan Ando)64 and rabbit anti-GFP(1:300, A11122, Invitrogen) rabbit anti-p-ASK1 (Thr845 ...
-
bioRxiv - Microbiology 2023Quote: ... The following antibodies were used for immunostaining: anti-Klebsiella pneumoniae (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... pneumoniae and PMN depletion was confirmed using anti-Gr-1 Rb6-antibodies (Invitrogen).
-
bioRxiv - Neuroscience 2020Quote: P1 mouse ventral mesencephalons were dissected in L-15 medium (Life Technologies) and dissociated in papain solution [12 U/mL papain (Worthington Biochemical) ...
-
bioRxiv - Microbiology 2020Quote: ... pneumoniae and followed with Alexa Fluor 488 goat anti rabbit antibody (Thermo Fisher Scientific). SH-SY5Y cells were stained with Phalloidin 594 (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse NIH3T3 fibroblasts (mycoplasma-free) were maintained in DMEM (Gibco) with 10% fetal calf serum (FCS ...
-
bioRxiv - Microbiology 2022Quote: ... pneumoniae was added to 100% active human (Invitrogen, Waltham, MA) or C57B/L6 murine serum (Invitrogen) ...
-
bioRxiv - Microbiology 2019Quote: ... pneumoniae isolates were stained with BacLight 488 (Thermo Scientific, USA) with slight changes to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... IHC for Spn was performed using rabbit anti-Streptococcus pneumoniae polyclonal antibody (Thermo Fisher scientific cat. # PA-7259) followed by biotin-labeled goat anti-rabbit IgG antibody (Thermo Fisher Scientific Cat.# ...
-
bioRxiv - Microbiology 2022Quote: ... pneumoniae strain D39 diluted in phosphate-buffered saline (PBS; Thermo Scientific) into the lateral tail vein [15 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein lysates were incubated with either EGFR (Ab-13) mouse antibody (Thermo Fisher Scientific, MS- 609-P1) or Ub (P4D1 ...
-
bioRxiv - Genetics 2021Quote: ... Antibodies against rhodopsin (RET-P1; Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... PECAM1 (Thermo Fisher Scientific; RB-1033-P1), CD11b (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... human Troponin T (ThermoFisher MS-295-P1), human CD68 (BioRad MCA5709) ...
-
bioRxiv - Neuroscience 2024Quote: ... P0-P1 mouse cerebral cortices were dissected and dissociated in 0.25% trypsin (PAA) in DMEM/F12 (Gibco, Invitrogen) for 15 min at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... P0-P1 mouse cerebral cortices were dissected and dissociated in 0.25% trypsin (PAA) in DMEM/F12 (Gibco, Invitrogen) for 15 min at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... EGFR (Thermo Fisher, Cat. No. MS-400-P1), ERK1/2 (Cell Signaling ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mucin (1:500, Thermo Scientific HM-1630-P1), Osteopontin (1:200 ...
-
bioRxiv - Biophysics 2019Quote: ... Primary neurons were isolated from P0-P1 mouse hippocampus using papain digestion and plated in Neurobasal A media (Invitrogen) with 2% Gem21 supplement (Gemini ...
-
bioRxiv - Cell Biology 2019Quote: ... The primary antibody TNNT2 (ThermoFisher Scientific, cat. MS295-P1) was diluted 1:2000 in flow buffer and incubated with the cells for 60 min at RT ...
-
bioRxiv - Immunology 2019Quote: ... pneumoniae for 6 hours in 1% FCS phenol free alpha MEM (base media, Life Technologies). Cells were washed three times in PBS and gently lifted from the plate using a cell scraper in 300μl of base media supplemented with 1mM EDTA ...
-
bioRxiv - Immunology 2021Quote: ... or rabbit anti-CD20 (#RB-9013-P1, diluted 1:200 in TBS, Thermo Fisher Scientific, Waltham, MA, USA) was applied over night at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... and back-blotted with filter paper (Whatman P1, Fisher Scientific) and allowed to dry ...
-
bioRxiv - Cell Biology 2020Quote: ... clone 13-11 (Thermo scientific MS-295-P1, 1:100), anti-sarcomeric α-actinin (Abcam ab68167) ...
-
bioRxiv - Cell Biology 2021Quote: ... clone 13-11 (Thermo Scientific, MS-295-P1; 1:200), sarcomeric α-actinin (Abcam ...
-
bioRxiv - Bioengineering 2020Quote: ... Primary (P1) were cultured in DMEM/F-12 (GIBCO: 11320082) containing 10% Heat Inactivated HyClone™ FetalClone™ II Serum (U.S. ...
-
bioRxiv - Biophysics 2022Quote: ... and P1 viruses were generated from Sf9 cells (Invitrogen, USA) after bacmid transfection ...
-
bioRxiv - Biophysics 2023Quote: ... P1 baculovirus was generated by transfecting ExpiSf9 cells (Gibco, A35243) cultured at 27 ˚C with polyethylenimine MW 40,000 (PolyScience ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells are tested for mycoplasma using the MycoFluor Mycoplasma Detection Kit (ThermoFisher, Waltham, MA, USA).
-
bioRxiv - Bioengineering 2024Quote: ... and Mycoplasma testing within 6 months using the MycoStrip Mycoplasma Detection Kit (Invitrogen, Waltham, MA). Cell lines were maintained in culture at 37°C in 5% CO2.
-
bioRxiv - Bioengineering 2024Quote: ... and Mycoplasma testing within 6 months with the MycoStrip Mycoplasma Detection Kit (Invitrogen, Waltham, MA). Cell lines were maintained in culture at 37°C in 5% CO2.
-
bioRxiv - Microbiology 2022Quote: ... pneumoniae K5962 and ϕKp24 were clipped and loaded into a Titan Krios (Thermo Fisher Scientific (TFS)) equipped with a K3 BioQuantum direct electron detector and an energy filter (Gatan ...
-
bioRxiv - Microbiology 2023Quote: ... pneumoniae KP35 were amplified by PCR using the Platinum SuperFi II High Fidelity DNA Polymerase (Invitrogen), and then joined by Gibson assembly (Fig ...
-
bioRxiv - Cell Biology 2020Quote: ... Mycoplasma contamination was assessed with a MycoFluor™ Mycoplasma Detection Kit (Catalog M7006, Thermo Fisher Scientific) and cells used for experiments were free of mycoplasma contamination.
-
bioRxiv - Biochemistry 2022Quote: ... All iPSC lines were also screened for mycoplasma contamination using a mycoplasma detection kit (ThermoFisher, 4460623). Once the test came back negative ...
-
bioRxiv - Cell Biology 2019Quote: ... cardiac Troponin T (cTnT, 1:100; Thermo Scientific, MS-295-P1), Wheat Germ Agglutinin (WGA ...
-
bioRxiv - Bioengineering 2022Quote: ... P1 (ATGTGGGCTGCCTAGAAAGG) and P2 (TTGGACATGAGCCAATATAAATG) using Phusion DNA polymerase (Thermo Fisher). The positive band from genotyping PCR was subjected to Sanger sequencing.
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibody for CK14 (Thermo Fisher Scientific, Cat# RB-9020-P1) was diluted 1:300 ...
-
bioRxiv - Immunology 2021Quote: ... Mycoplasma analysis was performed with Mycoplasma species 500 PCR kit at GeneAmp PCR System 2700 (Applied Biosystems). Quality control tests of the vaccine including levels of chemistry analysis (Na ...
-
bioRxiv - Microbiology 2021Quote: ... pneumoniae (one colony per species per plate) were further sub-cultured on Sheep Blood Agar plates (ThermoFisher) and species identity confirmed by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS ...
-
bioRxiv - Microbiology 2022Quote: ... pneumoniae serotype 2 strain D39 [17] was plated on brain heart infusion (BHI, Thermo Scientific, MA, USA) agar plates supplemented with 3% v/v defibrinated horse blood (Thermo Scientific ...
-
bioRxiv - Immunology 2020Quote: ... pneumoniae isolates were stored at −80°C in Luria-Bertani broth (LB; Thermo Fisher Scientific, Waltham, MA) supplemented with 15% glycerol.
-
bioRxiv - Microbiology 2024Quote: ... pneumoniae strains to a range of antibiotics was determined using broth microdilution (Trek Sensititre®, ThermoFisher Scientific) as per manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... mouse anti-mouse PCSK9 (Invitrogen), mouse anti-mouse vinculin (Santa Cruz) ...
-
bioRxiv - Biophysics 2021Quote: ... Testing for mycoplasma contamination was performed using the MicroFluor Mycoplasma Detection kit (catalog #M7006; ThermoFisher Scientific, Waltham, MA) at the time of the last passage and no contamination was detected.
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were certified free of Mycoplasma either internally using the MycoSEQ Mycoplasma detection kit (Thermo Fisher) or by IDEXX BioAnalytics using STAT-Myco testing ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were all confirmed to be mycoplasma negative using a PCR mycoplasma detection kit (Thermo Fisher Chemicals, J66117) following manufacturers instructions.
-
bioRxiv - Genetics 2021Quote: ... Tissues were incubated with primary antibodies against rhodopsin (RET-P1; Thermo Fisher Scientific ...