Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Mouse Anti Hepatitis C Virus NS3 Antibody 1859 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... or mouse anti-Hepatitis C virus Core protein (clone C7-50, Life Technologies) were visualised using IRDye 800CW Donkey anti-Rabbit IgG or Goat anti-Mouse IgG (LiCor) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... C and S genes of the Hepatitis B virus (accession number: KY00323035) was ordered from GeneArt (ThermoFisher Scientific) and is available from Addgene (Addgene # 179155).
-
bioRxiv - Microbiology 2019Quote: ... anti-DENV2 NS3 (Thermo Fisher cat: PA5-32199), anti-phospho-STAT1 (Tyr701 ...
-
bioRxiv - Microbiology 2019Quote: ... YFV RNA was quantified using NS3-specific primers and TaqMan probe (NS3-For CACGGCATGGTTCCTTCCA; NS3-MFAM CAGAGCTGCAAATGTC; NS3-Rev ACTCTTTCCAGCCTTACGCAAA) with TaqMan® RNA-to-CT™ 1-Step (Thermo Fisher Scientific) on a QuantStudio 6 Flex machin (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... blocked and incubated with Anti-Loqs or anti-NS3 primary antibodies at a dilution of 1:200 followed by incubation with Alexa-Fluor 488 secondary antibodies (Invitrogen) at a dilution of 1:500 ...
-
bioRxiv - Microbiology 2022Quote: ... anti-c-Myc mouse monoclonal antibody (1:1000, Thermo Fisher, 9E10), anti-P66 rabbit polyclonal antibody (1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... Loss of virus was monitored by staining with anti-Sendai virus antibody (Invitrogen, cat #14649482).
-
bioRxiv - Immunology 2022Quote: ... probed with mouse anti c-myc primary antibody (9E10, Thermo Fisher Scientific) then incubated with goat anti mouse Ig-horseradish peroxidase secondary antibody (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... Antibodies used: anti-Influenza A virus NS1 (PA5-32243, ThermoFisher), anti-acetyl-α-tubulin (Ly640 ...
-
bioRxiv - Biochemistry 2022Quote: Commercially available primary antibodies used: mouse anti-c-myc (Invitrogen, dilution immunoblot (IB) 1:2’000 ...
-
bioRxiv - Biochemistry 2024Quote: ... Commercially available antibodies were: Mouse anti-c-myc (Invitrogen, dilution WB: 1:2’000) mouse anti-HA (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... that co-localises with IBDV virus factories (16) and a goat anti-mouse secondary antibody conjugated to Alexa-Fluor 488 (Invitrogen). Wells were scored as positive or negative based on the presence of infected cells ...
-
bioRxiv - Microbiology 2021Quote: ... The attachment of HIV-1 virus produced in the presence of TMEM123 was also separately tested by pre-incubating the virus with mouse monoclonal anti-TMEM123 antibody (297617) (ThermoFisher) (25ug/ml ...
-
bioRxiv - Developmental Biology 2022Quote: ... and incubated with primary antibodies overnight at 4 °C (1:100 mouse anti CYP3A4 antibody, Life Technologies MA5-17064 ...
-
bioRxiv - Microbiology 2023Quote: ... The following pairs of primary antibodies were used: mouse anti-c-Met (#370100, Invitrogen) and rabbit anti-E-cadherin antibodies (#GTX100443 ...
-
bioRxiv - Microbiology 2019Quote: ... Other antibodies were obtained from commercial vendors as follows: Anti-coxsackie virus B3 antibodies (ThermoFisher), Anti-adenovirus A5 antibodies (ThermoFisher) ...
-
bioRxiv - Cell Biology 2020Quote: Mouse anti-c-Myc (MA1-980, Thermofisher) and Biotin anti-IL-1β (511703 ...
-
bioRxiv - Microbiology 2021Quote: ... mouse mAb anti-c-Myc (ThermoFisher, 9E10) and rabbit polyclonal anti-NF-κB p65 acetyl K310 (Abcam ab19870) ...
-
bioRxiv - Immunology 2022Quote: ... mouse anti-Influenza A Virus M1 (1:1,000; clone: GA2B; Cat#: MA1-80736; Invitrogen), mouse anti-Influenza A virus M2 (1:1,000 ...
-
bioRxiv - Immunology 2022Quote: ... mouse anti-Influenza A virus M2 (1:1,000; clone: 14C2; Cat#: MA1-082; Invitrogen), mouse anti-GAPDH (1:1,000 ...
-
bioRxiv - Microbiology 2021Quote: ... overnight at 4 °C followed by Goat-anti Mouse IgG-HRP secondary antibody (Invitrogen™) at room temperature for 2 hours ...
-
bioRxiv - Microbiology 2023Quote: ... overnight at 4 °C followed by Goat-anti Mouse IgG-HRP secondary antibody (Invitrogen™) at room temperature for 2 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were labeled with the rabbit anti-tau (C-terminal) antibody (MilliporeSigma) or the mouse anti-phospho-Tau (Thr181) Clone AT270 antibody (Thermo Fisher Scientific) at room temperature at dilution of 1:1000 in 1% BSA for 1 hour and then labeled with Alexa Fluor488 goat anti-mouse IgG secondary antibody at a dilution of 1:500 for 30 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... Cells infected with YFV were incubated with the pan-flavivirus anti-Env 4G2 antibody for 1h at 4°C and then with Alexa 488 anti-mouse IgG secondary antibodies (Thermo Fisher, #A28175) for 45 min at 4°C in the dark ...
-
bioRxiv - Bioengineering 2019Quote: ... 5×106 cells were labeled with a 1:100 dilution of chicken anti-c-myc antibody or mouse anti-V5 antibody (Thermo Fisher Scientific) for 15 minutes at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... and secondary antibody (Invitrogen anti-mouse antibody) binding ...
-
bioRxiv - Microbiology 2021Quote: ... anti-mouse Alexa488 antibody (Invitrogen), and Hoechst 33258 (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2022Quote: ... anti-mouse Alexa488 antibody (Invitrogen), and Hoechst 33258 (Santa Cruz Biotechnology) ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-c-myc (mAb 9E10, Life Technologies), mouse anti-acetylated Tubulin (mAb 6-11B-1 ...
-
CAP1 and cofilin1 cooperate in neuronal actin dynamics, growth cone function and neuron connectivitybioRxiv - Neuroscience 2020Quote: ... mouse anti-c-Myc (1:200, ThermoFisher Scientific) and chicken anti-mCherry (1:500 ...
-
bioRxiv - Genetics 2021Quote: ... Epitope-tagged bait proteins were detected with mouse anti-c-myc monoclonal antibody (Invitrogen, MA1-980) and IR-680 conjugated donkey anti-mouse secondary antibody (LI-COR ...
-
bioRxiv - Neuroscience 2022Quote: ... pH 7.4) and incubated at 4 °C with primary antibodies (Mouse anti-Cx26, 1:100, Invitrogen; Rabbit anti-Cx26 ...
-
bioRxiv - Neuroscience 2023Quote: ... for 72 h at 4°C and secondary antibody anti-mouse Alexa-488 (1:300, Invitrogen).
-
bioRxiv - Neuroscience 2023Quote: ... Transfected cells incubated in primary antibodies: mouse anti-c-myc 9E10 (1:1000, Invitrogen# 13-2500), rabbit anti-Tyr165 (1:250 ...
-
bioRxiv - Immunology 2022Quote: ... and anti-pp65 antibody (mouse, Argene) combined with goat anti-mouse antibody (AF488, Thermo Fisher), respectively.
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: ... Fixed cells were incubated with anti-MyHC antibodies (MF20) overnight at 4°C and then incubated with anti-mouse secondary antibodies labeled with Alexa fluor 594 (Invitrogen) for 1 hour at room temperature and counterstained with DAPI ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1hr before being incubated overnight at 4°C in and primary antibodies (1:1000 mouse anti-V5 Tag monoclonal Antibody (Invitrogen) and anti-Actin monoclonal antibody (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... the membranes were probed with the following primary antibodies at 4°C overnight: mouse anti-EphA4 C-terminus (Invitrogen, USA; 1:1000), goat anti-EphA4 N-terminus (R&D Systems ...
-
bioRxiv - Microbiology 2021Quote: ... followed by 30 minutes with 0.1% Tween/PBS at 37°C and 1 hour at 37°C with secondary antibody Alexa-488 goat anti-mouse (1:500) (Life Technologies #A11029) in 1% BSA/PBS before mounting with Prolong Gold with DAPI (Invitrogen #P36935) ...
-
bioRxiv - Neuroscience 2024Quote: ... OFC and mPFC sections were stained to visualize glial fibrillary acidic protein (GFAP) (primary antibody: mouse anti-GFAP antibody, Sigma-Aldrich; secondary antibody: donkey anti-mouse Alexa 594 antibody, ThermoFisher), and with fluorescent Nissl and DAPI ...
-
bioRxiv - Plant Biology 2021Quote: ... a mouse anti-FLAG primary monoclonal antibody was used (anti-DYKDDDDK FG4R, 1 μg/mL overnight at 4 °C, Invitrogen), and horseradish peroxidase (HRP)-coupled goat anti-mouse IgG was used as a secondary antibody horseradish peroxidase (0.5 μg/mL for 1 hr at 21 °C ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated for three hours at 37°C in 2% BSA in PBS complemented with secondary antibody (goat anti-rabbit-Oregon Green, goat anti-mouse-A594, Invitrogen). Gels were washed three times in PBST before a second overnight expansion in ddH2O ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated at 4 °C with primary antibodies (Mouse anti-Cx26, 1:100, Invitrogen; Rabbit anti-Cx26; 1:250, Invitrogen; Rabbit anti-Cx30 ...
-
bioRxiv - Immunology 2022Quote: ... the cells were incubated for 90 min at 37 °C with AlexaFluor-488 conjugated goat anti-mouse and AlexaFluor-568 goat anti-rat antibodies and DAPI (Invitrogen). Fluorescence microscopy was performed using a Nikon Structured illumination microscope (N-SIM ...
-
bioRxiv - Biochemistry 2019Quote: ... and anti-mouse-alexa488 antibody (Invitrogen). Cells were fixed with 1% formaldehyde and analyzed on a BD FACSCalibur (BD Biosciences).
-
bioRxiv - Microbiology 2022Quote: ... Mouse-anti-His (HIS.H8) antibody (Invitrogen) (for eGFP/His-tagged NP protein co-immunoprecipitation ...
-
bioRxiv - Physiology 2020Quote: ... and mouse anti-Cldn5 antibodies (Invitrogen, cat#33-1500.
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-TMEM123 Antibody (297617) (Invitrogen), mouse anti-PODXL1 Antibody (222328 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-IL-1β antibody (Invitrogen), mouse anti-MCP-1 antibody (Abcam) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... or rabbit anti-mouse antibody (Invitrogen). The membranes were again washed with TBST 3x for 5 min ...