Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for MLKL Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... MLKL polyclonal antibody (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Vinculin Rabbit mAb (# 700062; Invitrogen), p-H3 Rabbit mAb (S10 ...
-
bioRxiv - Cell Biology 2024Quote: ... rabbit anti-MLKL (clone 2B9; RRID:AB_2717284; 1g/L; Thermo Fisher Scientific Cat#MA5-24846), rabbit anti-MLKL (clone EPR17514 ...
-
bioRxiv - Microbiology 2022Quote: ... rabbit mAb (#4394); IKKβ (D30C6) rabbit mAb (#8943); phospho-IKKα (Ser176)/IKKβ (Ser177) (C84E11) rabbit mAb (#2078; blocked with SuperBlock (Thermo Scientific)) ...
-
bioRxiv - Microbiology 2020Quote: Recombinant human mAbs were expressed in Expi293 HEK cells (Life Technologies), which were maintained in suspension at 37°C and 8% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant mAbs were then produced in EXPi293F cells (Life Technologies, USA) by transfecting pairs of the IgG1 heavy and light chain expression plasmids ...
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Systems Biology 2021Quote: ... secondary mAB anti-goat HRP (rabbit, Invitrogen, 611620), secondary mAB anti-mouse (sheep ...
-
bioRxiv - Microbiology 2022Quote: ... NF-kB2 p100/p52 (D7A9K) rabbit mAb (#37359); phospho-NF-κB2 p100 (Ser866/870) rabbit mAb (#4810; blocked with SuperBlock (Thermo Scientific)) ...
-
bioRxiv - Biochemistry 2021Quote: ... Clarified cell supernatant containing recombinant mAb was passed over Protein A Agarose resin (Thermo Fisher Scientific). Protein A resin was extensively washed with 25 mM Phosphate pH 7.4 ...
-
bioRxiv - Cell Biology 2024Quote: ... rabbit recombinant ANTI-FLAG M2 antibody (Invitrogen 710662), guinea pig anti-bovine insulin (Linco ...
-
bioRxiv - Microbiology 2021Quote: ... were incubated with the MprF- or lysozyme-specific humanized IgG mAB and/or a GFP-specific rabbit IgG mAB (Invitrogen) for 30 min shaking at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... ISG15 recombinant rabbit monoclonal antibody (1□00) (Invitrogen, 703132), and collagen I (1□100 ...
-
bioRxiv - Cell Biology 2021Quote: Mlkl-/- MDF cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Gibco) supplemented with 8% (v/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... Supernatant was collected 6 days later and recombinant mAb was purified using protein A agarose (Thermo Fisher Scientific) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... Recombinant human IgG1 mAbs were produced by co-transfection of Freestyle 293-F suspension cells (Thermo Fisher Scientific) as previously described 57 and purified by affinity chromatography using protein G sepharose 4 fast flow beads (GE Healthcare).
-
bioRxiv - Microbiology 2022Quote: ... Recombinant human IgG1 mAbs were produced by co-transfection of Freestyle 293-F suspension cells (Thermo Fisher Scientific) as previously described 48 and purified by affinity chromatography using protein G sepharose 4 fast flow beads (GE Healthcare).
-
bioRxiv - Bioengineering 2023Quote: ... and Col1A1 (E8F4L) XP Rabbit mAb cell signaling (Catalog 72026, ThermoFisher Scientific) with Donkey anti-Rabbit IgG (H+L ...
-
bioRxiv - Microbiology 2023Quote: ... Alexa Fluor 647-conjugated anti-β-tubulin (9F3) rabbit mAb (Thermo Fisher Scientific) to visualize cilia ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... AHR (1 μg/ml, Rabbit mAb JM34-10, Thermo Fisher Scientific MA5-32576), CYCLIN B1 (1:10,000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Ki-67 recombinant rabbit monoclonal antibody (SP6) (Thermofisher, Cat. #: MA5-14520), Goat anti-Mouse IgG (H+L ...
-
bioRxiv - Neuroscience 2020Quote: ... We used GFP recombinant rabbit monoclonal antibody (G10362, Thermo Fisher Scientific) at 1:300 dilution and monoclonal anti-GFP ...
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant rabbit monoclonal anti-LUM (Lumican, Invitrogen Cat#MA5-29402). The samples were subsequently digitized using a NanoZoomer Hamamatsu S60 digital slide scanner.
-
bioRxiv - Synthetic Biology 2024Quote: ... Staining with DYKDDDDK Tag Recombinant Rabbit Monoclonal Antibody (8H8L17, Invitrogen, 701629) at 1:500 dilution was performed in blocking solution at 4℃ for 14 hours ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse and rabbit mAbs were expressed by transient transfection of ExpiCHO cells (Thermo Fisher) with equal amount of paired heavy and κ-light chain plasmids and purified from the culture supernatant after 12-14 days using Protein A beads columns (Thermo Fisher).
-
bioRxiv - Immunology 2024Quote: ... Rabbit mAb directed at phospho-JAK2 (Tyr1007/1008) was obtained from Invitrogen (Eugene, OR). Bacterial LPS and N-acetylcysteine (NAC ...
-
bioRxiv - Immunology 2021Quote: ... anti-p24 mAb (AG3.0) and anti-GAPDH mAb (Life Technologies) followed by goat anti-mouse HRP-conjugated second antibody (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... anti-p24 mAb (AG3.0) and anti-GAPDH mAb (Life Technologies) followed by goat anti-mouse HRP-conjugated second antibody (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20× Taqman Gene Expression assay probes (Ripk1, Hs01041869_m1; Ripk3, Hs00179132_m1; Mlkl, Hs04188505_m1; Applied Biosystems). qPCR reactions were done using an ABI Prism 7900HT (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2019Quote: ... Mlkl expression relative to GAPDH control was determined using SDS version 2.3 program (Applied Biosystems) and expressed as ΔCT values.
-
bioRxiv - Immunology 2021Quote: ... followed by anti-rabbit or anti-mouse horseradish peroxidase(HRP)-conjugated secondary mAb (ThermoFisher scientific) [4] ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-claudin-4 mAb (#32-9400), rabbit anti-tricellulin mAb (clone 54H19L38, #700191) and rabbit anti-ZO-2 pAb (#71-1400) were purchased from Thermo Fisher Scientific (MA ...
-
bioRxiv - Microbiology 2020Quote: ... coli-derived recombinant BAG1) and secondary goat anti-rabbit 594 (1:1000, Invitrogen).
-
bioRxiv - Neuroscience 2020Quote: ... to enhance viral expression (primary antibody: GFP Recombinant Rabbit Monoclonal Antibody, Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... The primary (E-Cadherin [24E10] Rabbit mAB) and secondary (Goat anti-Rabbit Alexa 488) antibody was purchased form Cell Signaling Technology and Invitrogen (Thermo Fisher Scientific) respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... The blot was further evaluated for G6PD expression using primary antibody against G6PD (Rabbit mAb # A11234) and the counter labelling anti-rabbit HRP secondary antibody (Invitrogen Catalog # 31460). Chemiluminescence was capture in iBright (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... anti-His mAb (Invitrogen) and anti-GAPDH mAb (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: MAb production was performed by transiently expressing mAb constructs in Expi293F cells (ThermoFisher) using polyethylenimine reagent ...
-
bioRxiv - Cell Biology 2022Quote: ... Immunocytochemistry was performed using primary GFP-specific rabbit monoclonal antibody (mAb) (Invitrogen-A1122; used at 1:250) and primary mouse anti-α tubulin mAb (Sigma-T9026 ...
-
bioRxiv - Cell Biology 2019Quote: ... Immunocytochemistry was performed using primary GFP-specific rabbit monoclonal antibody (mAb) (Invitrogen-A1122; used at 1:250) and primary mouse anti-α tubulin mAb (Sigma-T9026 ...
-
bioRxiv - Cell Biology 2019Quote: ... Immunocytochemistry was performed using primary GFP-specific rabbit monoclonal antibody (mAb) (Invitrogen-A1122; used at 1:250) and primary mouse anti-α tubulin mAb (Sigma-T9026 ...
-
bioRxiv - Cell Biology 2020Quote: ... Immunocytochemistry was performed using primary GFP-specific rabbit monoclonal antibody (mAb) (Invitrogen-A1122; used at 1:250) and primary mouse anti-α tubulin mAb (Sigma-T9026 ...
-
bioRxiv - Cell Biology 2023Quote: ... Immunocytochemistry was performed using primary GFP-specific rabbit monoclonal antibody (mAb) (Invitrogen-A1122; used at 1:250) and primary mouse anti-α tubulin mAb (Sigma-T9026 ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were treated with a Kv1.1 recombinant rabbit monoclonal antibody (SN66-06, ThermoFisher Scientific) overnight and with an Alexa-488 conjugated secondary antibody for two hours on the following day ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were stained with anti-CD64 (CD64 Recombinant Rabbit Monoclonal Antibody, Thermofisher, # MA5-29706) at a dilution of 1:400 in 1% BSA in PBS and incubated at 4°C overnight in the dark overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA interference was performed using 10 pmol of duplexes targeting human MLKL (GCAACGCAUGCCUGUUUCACCCAUA, Stealth siRNA from Life Technologies) or non-silencing control duplexes (low-GC 12935111 ...
-
bioRxiv - Cell Biology 2019Quote: ... ∼0.5 μg of cDNA was then used in a TaqMan PCR reaction with Universal PCR mastermix and murine Mlkl (Mm1244222_n1) and GAPDH (Mm99999915_m1) Taqman probes (ThermoFisher) on an ABI 7900 Fast Real-Time PCR instrument (Applied Biosystems) ...
-
bioRxiv - Pathology 2021Quote: ... The APP mAb 22C11 (Invitrogen) was used at a dilution of 1:3,000 for western blot.
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-His mAb (Invitrogen) and anti-GAPDH mAb (Life Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD8 MAb (ThermoFisher) were employed at 1/50 dilution.