Labshake search
Citations for Thermo Fisher :
1 - 50 of 4848 citations for IGF2 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-IGF2 (ThermoFisher, PA5-71494), and Anti-bACTIN (ThermoFisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... Concentration of endogenous Igf2 was measured with a mouse Igf2 ELISA kit (Thermo Fisher Scientific, EMIGF2). Because of the low Igf2 concentration ...
-
bioRxiv - Cancer Biology 2021Quote: ... IGF2 (Thermo Fisher #MA5-17096; 1:200); Ki-67 (SolA15 ...
-
bioRxiv - Developmental Biology 2021Quote: ... a mouse 110 kb BAC clone encoding Nctc1 and Igf2 was purchased from Thermo Fisher Scientific (RPCI23.C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The qPCR was performed using TaqMan Gene Expression Assays that consisted of forward and reverse primers with TaqMan minor groove binder (MGB) probe for each gene (Zbed6: Mm04178798_s1, Igf2: Mm00439564_m1, 18S: Mm03928990_g1, Applied Biosystems); 18S and was used as housekeeping gene ...
-
bioRxiv - Microbiology 2020Quote: ... containing the proximal promoter of the murine Igf2 P3 (58, 59) was synthetized by the GeneArt Gene Synthesis service (Thermo Fisher Scientific). TSS sequence was localized with EPD database (60) ...
-
bioRxiv - Microbiology 2024Quote: ... and human (goat anti-human IgG, ThermoFisher) were also used ...
-
bioRxiv - Pathology 2022Quote: ... human CTRP3 (Invitrogen, PA5-115061, rabbit anti-human), α-SMA-Cy3 (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... human (Invitrogen). Cells were cultured in DMEM (Corning Cellgro 10-013-CV ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 10 μL human IgG (Human IgG Isotype Control, ThermoFisher Scientific #02-7102 ...
-
bioRxiv - Neuroscience 2021Quote: ... Hs05441121_cn (human) (ThermoFisher). This line has been submitted to the European Mouse Mutant Archive (EMMA ...
-
bioRxiv - Neuroscience 2021Quote: ... Hs06560655 (human) (ThermoFisher).
-
bioRxiv - Cell Biology 2024Quote: ... Human fibronectin (Invitrogen) was added to stamps at a concentration of 40 µg/ml for 1 hour ...
-
bioRxiv - Cell Biology 2020Quote: ... and VIC labelled human β actin endogenous control probe (Human - 4326315E) or RNA28S5 (Human - Hs03654441_s1) (Thermo Fisher Scientific) so that amplified mRNA can be normalised to β actin or RNA28S5 ...
-
bioRxiv - Neuroscience 2021Quote: ... Human recombinant fibroblast growth factor (human FGF2) (10 ng/ml, Invitrogen) was added to Dulbecco’s Modified Eagle’s Medium (DMEM)/F-12 (Gibco) ...
-
bioRxiv - Immunology 2022Quote: ... Human T cells were activated with human CD3/CD28 Dynabeads (Invitrogen), at a bead:cell ratio of 2:1 and transduced using supernatant collected from Phoenix-AMPHO cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibodies used for human samples were anti-human CD31 (#17031942, Invitrogen), anti-human CD45 (#17945942 ...
-
bioRxiv - Cancer Biology 2021Quote: ... human BNIP3 (Hs00969291_m1) and human 18S (Hs99999901_s1) were purchased from Applied Biosystems. 18S served as an internal control ...
-
bioRxiv - Microbiology 2022Quote: Human monoclonal antibodies were produced recombinantly in human Expi293F cells (Life Technologies) as described before (83) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human transferrin-568 (ThermoFisher) was added at 10μg mL−1 concentration in serum free media and incubated at 37°C to allow for internalization ...
-
bioRxiv - Immunology 2021Quote: ... then anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 50 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: Probes Hs00171064_m1 (human, ThermoFisher), Mm00440280_g1 (mouse ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary human hepatocytes (Gibco) were seeded in the top channel at a density of 3.5 x 106 cells/mL using complete hepatocyte seeding media ...
-
bioRxiv - Immunology 2020Quote: ... or anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 25 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... or human IgG (Invitrogen) as control ...
-
bioRxiv - Bioengineering 2022Quote: ... and human fibronectin (Gibco) at 50 μg/mL in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... human (ThermoFisher Scientific, 902927). Analysis was performed with Transcriptome Analysis Console 4.0 software (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... then anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 50 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% human IgG (Invitrogen) in PBS] followed by incubation with primary antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... human plasma (ThermoFisher, #33016015); Laminin 111 ...
-
bioRxiv - Immunology 2023Quote: ... A Human ProcartaPlexTM (Invitrogen) immunoassay was additionally used to detect 45 human cytokines ...
-
bioRxiv - Immunology 2024Quote: ... Anti-Human-HRP (Invitrogen) was diluted 1:5000 in 1% BSA/PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... CD36 (Human tissue Thermofisher: PA1-16813 1:500 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were tested on preconfigured 96-well qPCR plates (Human glycosylation – 4413255, Human Inflammation - 4418851 or Human tumor metastasis – 4418743, Thermofisher Scientific), with 100 ng added to each well ...
-
bioRxiv - Microbiology 2020Quote: ... we used human monoclonal antibodies produced recombinantly in human Expi293F cells (Life Technologies) as described before (Fang et al ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-human IgG-Alexa647 and anti-human IgG-Alexa568 were obtained from Invitrogen, anti-acetylated tubulin (T7451 ...
-
bioRxiv - Cell Biology 2020Quote: ... and human GAPDH and human KIF18A Taqman probes and primers (Thermo Fisher Scientific) were used for reverse transcription and qRT-PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... and subjected to human total tau ELISA (human tau: # KHB0042, Thermo Fisher Scientific) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.