Labshake search
Citations for Thermo Fisher :
1 - 50 of 2249 citations for ICOS Rhesus Macaque HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Cryopreserved rhesus macaque PBMCs were thawed in pre-warmed AIM-V media (Thermo Fisher Scientific) with Benzonase (EMD Millipore) ...
-
bioRxiv - Immunology 2020Quote: ... Cryopreserved rhesus macaque PBMCs were thawed in pre-warmed AIM-V media (Thermo Fisher Scientific, US) with Benzonase (EMD Millipore ...
-
bioRxiv - Immunology 2023Quote: ... HSC-F cells (cynomolgus CD4+ T-cell line) and HSR5.4 cells (rhesus macaque CD4+ T-cell line) were maintained in RPMI1640 (Invitrogen) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2023Quote: ... Rhesus macaque liver samples (∼100mg) were homogenized using the lysis buffer provided with the PureLink RNA Mini Kit (Life Technologies) using the FastPrep-24 kit (MP Bio) ...
-
bioRxiv - Immunology 2021Quote: Excised granulomas from Erdman-mCherry fluorescent Mtb-infected rhesus macaques were fixed overnight in 4% paraformaldehyde and subsequently embedded in Optimal cutting temperature compound (OCT, Fisher Scientific) and stored at -80°C ...
-
bioRxiv - Neuroscience 2019Quote: ... labeled using the Encore Biotin module (Nugen) and loaded for transcriptome analysis on a GeneChip™ Rhesus Macaque Genome Array (ThermoFisher scientific), designed to assess expression levels of transcripts in the macaque monkey genome ...
-
bioRxiv - Immunology 2021Quote: ... ICOS-PECy7 (ISA-3, Invitrogen), CD3-APC-Vio770 (BW264/56 ...
-
bioRxiv - Immunology 2021Quote: ... ICOS-PECy7 (ISA-3, Invitrogen), CD3-APC-Vio770 (BW264/56 ...
-
bioRxiv - Immunology 2023Quote: ... ICOS-Super Bright 436 (Invitrogen), CD69-PE-Cy5 (Biolegend) ...
-
bioRxiv - Genomics 2023Quote: ... Anti-ICOS (Clone ISA-3, ThermoFisher), in-house biotinylated Anti-CD6 or in-house biotinylated Anti-CD27 into streptavidin-coated plates (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... ICOS (clone: 7E.17G9, Thermo Fisher Scientific), IFNγ (clone ...
-
bioRxiv - Immunology 2022Quote: ... ICOS-SB436 (ISA-3, Invitrogen, 1:50), IgG-BV480 (goat polyclonal ...
-
bioRxiv - Immunology 2023Quote: ... anti-ICOS PerCP-Cy5.5 (ThermoFisher 7E.17G9), anti-B220 eFluor 450 (RA3-6B2) ...
-
bioRxiv - Biochemistry 2024Quote: ... hamster (Syrian Hamster Isoform X1 – UniProt: A0A1U8BWQ2) and macaque (Macaque – UniProt: F6SVR2) with an N-terminal cMYC-tag were ordered to GeneArt (Thermo Fisher Scientific) and cloned into a phCMV backbone (GeneBank ...
-
bioRxiv - Immunology 2022Quote: ... and CD278/ICOS PE (ISA-3, Thermo Fisher Scientific). Cells were stained as described above ...
-
Co-stimulatory molecules decide T cell fate through regulations of their invigoration and impairmentbioRxiv - Molecular Biology 2022Quote: ... gRNA (CD28: TCGGCATTCGAGCGAAACTG, ICOS: AGGTTCCTTTCTTGAAAAGG) with Cas9 protein (Thermo Fisher) was incubated for 5 min ...
-
bioRxiv - Microbiology 2021Quote: HEK293/TLR4 and HEK293/null cells (both Invitrogen) were maintained in 4.5 g/L glucose DMEM (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 T-Rex (referred to as HEK293, cat.no. R71007, Invitrogen) and NIH3T3 cells were grown in DMEM Glutamax® (Thermo Fisher Scientific ...
-
Modified N-linked glycosylation status predicts trafficking defective human Piezo1 channel mutationsbioRxiv - Biophysics 2020Quote: ... HEK293S GnT1-/- or HEK293 cells (ThermoFisher Scientific, Cat. No. R78007) using Lipofectamine 3000 transfection reagent (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells (Invitrogen) were grown in DMEM (1g/L glucose ...
-
bioRxiv - Synthetic Biology 2022Quote: HEK293 cells (ThermoFisher; further authenticated by assessing cell morphology and growth rate ...
-
bioRxiv - Microbiology 2021Quote: The rhesus monkey kidney epithelial MA104 cells were grown in medium 199 (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2023Quote: Telomerized rhesus fibroblasts (TeloRFs) were maintained in Dulbecco’s modified Eagle medium (DMEM, Gibco) containing 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2022Quote: HEK293 and commercially available Flp-In T-REx HEK293 cells (Invitrogen; R78007) were cultured in DMEM (GIBCO ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 cells (ThermoFisher Scientific) were cultured in DMEM/F-12 ...
-
bioRxiv - Bioengineering 2022Quote: ... FreeStyle HEK293 cells (ThermoFisher) were used for recombinant S protein production ...
-
bioRxiv - Molecular Biology 2019Quote: ... HEK293 FT cells (ThermoFisher) were co-transfected with plasmids pCMV-dR8.2 dvpr (gag-pol ...
-
bioRxiv - Synthetic Biology 2019Quote: HEK293 cells (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: HEK293 cells (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293-FT (Invitrogen # R70007) cells were grown in Dulbecco’s Modified Eagle Medium (ThermoFisher #11965118 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 (Thermo Fisher Scientific) were cultured in DMEM (Dulbecco’s Modified Eagle Medium ...
-
bioRxiv - Neuroscience 2020Quote: The macaque retinae were cut into pieces and lysed by Trizol (Life Technologies, USA), including Cas9-RHO- and Cas9-CTRL-infected and uninfected retinae ...
-
bioRxiv - Immunology 2021Quote: ... following the manufacturer’s instructions and with Rhesus-specific TaqMan gene expression primers (Life Technologies). Eukaryotic 18S rRNA (Life Technologies ...
-
bioRxiv - Biochemistry 2022Quote: HEK293 wild type (ATCC, #CRL-1573) and HEK293 Flp-in T-REx (ThermoFisher, #R78007) wild type cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Molecular Biology 2024Quote: HEK293 Flp-In T-REx cells (or HEK293 T-REx; Thermo Fisher Scientific, R78007) and HEK293 cells [American Type Culture Collection (ATCC) ...
-
bioRxiv - Immunology 2021Quote: ... samples collected from challenged macaques or standards were reverse-transcribed using Superscript III VILO (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: Heart tissues from mice or rhesus monkeys were crushed by homogenizer (Power Gen125, Fisher Scientific) and then lysed in lysis buffer (50 mM Tris ...
-
bioRxiv - Cancer Biology 2021Quote: HEK293-FT (Thermo Fisher Scientific) were cultured in DMEM supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2021Quote: ... HEK293 Freestyle suspension cells (ThermoFisher), and immortalized human cord blood-derived mesenchymal stromal cells (cbMSCs ...
-
bioRxiv - Neuroscience 2020Quote: HEK293-FT (RRID:CVCL_6911, Thermo Scientific) cells were grown in DMEM containing 10% FBS ...
-
bioRxiv - Molecular Biology 2022Quote: HEK293-FlpIn cells (ThermoFisher Scientific) were transfected with empty vector (negative control ...
-
bioRxiv - Biochemistry 2022Quote: HEK293 FlpIn-TRex cells (Invitrogen) were cultured in DMEM (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: HEK293 FlpIn-TRex cells (Invitrogen) were cultured in DMEM (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293-FT (Thermo Fisher Scientific) were cultured in DMEM with 10% FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293-FT (Thermo Fisher Scientific) in DMEM with 10% FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293-F cells (ThermoFisher R79007) were transfected with the transfer plasmid and the packaging plasmids (Addgene plasmids #12263 and #8454 ...
-
bioRxiv - Evolutionary Biology 2024Quote: Macaque endometrial biopsies or mouse uterine horns were rinsed with DPBS without Ca2+/Mg2+ (Gibco, 14190144), and cut into small pieces with dissecting scissors in a Petri dish containing 200 ul of ice-cold DMEMF12 (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 stably expressing the tetracycline (tet)-repressor (Flp-In T-REx HEK293, Invitrogen, Carlsbad, CA, USA) were cultured as above with the addition of 50 μg/mL zeocin and 5 μg/mL blasticidin (Invitrogen ...
-
bioRxiv - Biochemistry 2019Quote: HEK293 cells: HEK293 cells (CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045) were cultured in DMEM high glucose (Gibco) and supplemented with 10% FCS (Gibco) ...
-
bioRxiv - Biochemistry 2021Quote: ... FreeStyle HEK293 cells (Thermo fisher scientific) were transfected with pcDNA3.1 vector encoding for HSulf-2 cDNA flanked by TEV cleavable SNAP (20.5 kDa ...