Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Human Eukaryotic Translation Initiation Factor 1 EIF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and the murine housekeeping gene eukaryotic translation elongation factor-1α (EF1a; assay ID: VB1-14428-VT, Affymetrix, Inc.), that shares 95% sequence identity with the Syrian hamster ...
-
bioRxiv - Microbiology 2021Quote: ... in vitro synthesized guide RNA (sgRNAs) that were designed to cut shortly after the translation initiation codon in Ajuba Exon 1 were ordered from ThermoFisher’s sgRNA service (CCGGAGTCCGAGAGTCTCAACTT) ...
-
bioRxiv - Cell Biology 2024Quote: ... SASP factors: human IL-8 Uncoated ELISA (88-8086-88, Invitrogen), human IL-6 Uncoated ELISA (88-7066-88 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... interleukin-6 and -8 (IL-6 and IL-8) human Instant Elisa™ kits and matrix metalloproteinase-1 (MMP-1) human Elisa kit from ThermoFisher Scientific.
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Immunology 2021Quote: ... IL-2 Human Uncoated ELISA kit and IFNγ Human Uncoated ELISA kit (both from Invitrogen) and DuoSet Human IFN-gamma kit and Ancillary Reagent Kit 2 (R&D Systems ...
-
bioRxiv - Pathology 2022Quote: ... Aβ42 human ultrasensitive ELISA Kit and Tau (phospho) [pT231] human ELISA Kit from Thermo Fisher, and sAPPα and sAPPβ ELISA Kit from Mybiosource ...
-
bioRxiv - Cell Biology 2019Quote: ... ELISAs were performed using FBLN5 (Fibulin-5) Human ELISA Kit from Fine Test (EH0772) and Thrombospondin 1 (TSP1) Human ELISA Kit from Invitrogen (BMS2100), following the manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2023Quote: ... Aβ42 human ultrasensitive ELISA Kit (Thermofisher), and D2R (Mybiosource) ...
-
bioRxiv - Neuroscience 2023Quote: ... Human Aβ42 ELISA kit (Invitrogen-KHB3441)
-
bioRxiv - Molecular Biology 2022Quote: ... Human TNF-α Ultrasensitive ELISA Kit (Invitrogen,KHC3014 [96 tests] and Human IFNα ELISA Kit [Invitrogen,BMS216TEN]) were used for cytokine quantification.
-
bioRxiv - Neuroscience 2020Quote: Levels of total APOE protein were analysed by Human ELISA Kit from Invitrogen (Apolipoprotein E Human ELISA Kit). Levels of Aβ were analysed by ELISA (Human β Amyloid 42 ELISA Kit Wako high sensitive #298-64401 and Human β Amyloid 40 ELISA Kit Wako #298-64601 ...
-
bioRxiv - Molecular Biology 2020Quote: ... supernatants were diluted 4-fold and assayed with the Amyloid beta 40 Human ELISA Kit and either the Amyloid beta 42 Human ELISA Kit or the Amyloid beta 42 Human ELISA Kit Ultrasensitive (Invitrogen), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... and ELISA analysis (human IL-1β ELISA Kit, Thermo Fisher Scientific) according to the manufacturer ‘s instructions.
-
bioRxiv - Neuroscience 2022Quote: ... the human Aβ42 Ultrasensitive ELISA Kit (Invitrogen) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... the Human Osteopontin ELISA kit (Thermo Fisher) was used following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and the HGF Human ELISA Kit (Invitrogen) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human TNF-α Ultrasensitive ELISA Kit (Invitrogen,KHC3014 [96 tests] and Human IFNα ELISA Kit [Invitrogen,BMS216TEN] ...
-
bioRxiv - Cancer Biology 2021Quote: ... Equal amounts of conditioned media were analyzed by ELISA (IL-1 beta Human ELISA Kit, Thermofisher KHC0011), using manufacturer protocol ...
-
bioRxiv - Microbiology 2022Quote: ... We determined sIgA concentrations by ELISA (Human IgA ELISA kit; Thermo Fisher), replacing the provided monomeric IgA standards with sIgA ELISA standards (Abnova) ...
-
bioRxiv - Cancer Biology 2021Quote: Hypoxia-inducible factor 1-alpha (HIF-1α) was evaluated using a HIF-1 Alpha ELISA Kit (Invitrogen™). Procedure steps were followed according to the manufacturer’s instructions and results were monitored at 450 nm using a microplate reader (iMARK™ ...
-
bioRxiv - Immunology 2021Quote: ... and IFN-γ Human Uncoated ELISA Kit (Invitrogen), respectively ...
-
bioRxiv - Cell Biology 2021Quote: The proBNP/NPPB human sandwich ELISA kit (Invitrogen) was used to determine the level of secreted human proBNP ...
-
bioRxiv - Neuroscience 2023Quote: ... and IL-1RA Human ELISA Kit (ThermoFisher, KAC1181). Protein concentrations were calculated per manufacturer’s instructions in pg/mL ...
-
bioRxiv - Cancer Biology 2019Quote: ... Amyloid Beta-40 ELISA was performed using the Human AB40 ELISA Kit (Invitrogen). Secretion values were normalized to protein content of wells as measured by RIPA harvest and BCA protein quantification.
-
bioRxiv - Cell Biology 2023Quote: ... These constructs were then used for in vitro translation using a HeLa cell lysate-based Kit (1-Step Human Coupled IVT Kit—DNA, 88881, Life Technologies). The in vitro-translated proteins were then purified using His Pur cobalt spin columns (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2022Quote: The 5 kbp putative promoter fragment upstream of the translation initiation codon of each gene was cloned into pENTR4 dual-selection vector (Thermo Fisher SCIENTIFIC, USA) using an In-Fusion HD cloning kit ...
-
bioRxiv - Microbiology 2019Quote: Human IL-18 and TNFα were measured with the human IL-18 ELISA Kit (MBL, Woburn, Massachusetts) and human TNFα ELISA Kit (ThermoFisher, Waltham, Massachusetts) according to the manufacturers’ instructions using cell culture supernatant at a 1:5 dilution ...
-
bioRxiv - Immunology 2021Quote: ... IFN beta human ELISA kit (Thermo Fisher Scientific; 414101) was used to quantify IFNB1 ...
-
bioRxiv - Immunology 2022Quote: ... Human IFN gamma Uncoated ELISA kit (88-7316, Invitrogen) and IL-2 Human Uncoated ELISA Kit (88-7025 ...
-
bioRxiv - Neuroscience 2023Quote: ... Human IL-6 ELISA kit was from Life Technologies. FAN1KO HD patient fibroblasts were generated and received from Synthego ...
-
bioRxiv - Physiology 2024Quote: ... Initiation media contained 1% bovine serum albumin (Thermofisher™, B14) ...
-
bioRxiv - Cancer Biology 2022Quote: ... ELISA was performed with Human IL-8 ELISA Ready-SET-Go kit (Affymetrix eBioscience) according to manufacturer’s protocol.
-
bioRxiv - Biophysics 2020Quote: Expression was conducted according to the manual of 1-Step Human High-Yield Mini in vitro translation (IVT) kit (Product No. 88891X) distributed by ThermoFisher Scientific (Pierce Biotechnology ...
-
bioRxiv - Microbiology 2020Quote: ... Enzyme-linked immunosorbent assays (ELISAs) for human IL-8 were performed using the Human IL-8 ELISA Kit (ThermoFisher SCIENTIFIC) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: The IL-2 ELISA was performed using the IL-2 Human ELISA Kit by ThermoFisher scientific according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... ELISA was performed using IFN gamma Human Uncoated ELISA Kit (Thermo Fisher Scientific, Massachusetts, USA). For assessing cytotoxicity 5 × 103 RPMI 8226 cells expressing luciferase-GFP were co-cultured with the different effector T cells at several effector ...
-
bioRxiv - Molecular Biology 2019Quote: ... for unperturbed samples or RiboMinus Eukaryotic Kit v2 (ThermoFisher, A15020) for PlaB/DMSO samples ...
-
bioRxiv - Neuroscience 2020Quote: ... was measured with Human Aβ Ultrasensitive ELISA Kit (Invitrogen, #KHB3544).
-
bioRxiv - Immunology 2022Quote: ... following the manufacturer’s instructions (TNF beta Human ELISA Kit, ThermoFisher).
-
bioRxiv - Molecular Biology 2019Quote: ... The Human Erythropoietin Platinum ELISA kit (Affymetrix cat. no. BMS2035) was used as per manufacturer’s suggested protocol.
-
bioRxiv - Immunology 2021Quote: Human IL-2 Ready-SET Go! ELISA kit (eBioscience/Invitrogen) or Human TNF alpha ELISA Ready-SET-Go! (eBioscience/Invitrogen ...
-
bioRxiv - Immunology 2020Quote: Human IL-2 Ready-SET Go! ELISA kit (eBioscience/Invitrogen) or Human TNF alpha ELISA Ready-SET-Go! (eBioscience/Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: The IL-6 Receptor (Soluble) Human ELISA Kit (Invitrogen; BMS214) was used as per the manufactures instructions to quantify soluble IL-6R expression in day 14 MGL and day 18 NPC vehicle/treated cell culture media ...
-
bioRxiv - Cell Biology 2023Quote: ... and 25 applying Albumin Human ELISA Kit (Cat.No. EHALB, ThermoFisher) on 24 h conditioned medium according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: Aβ40 and Aβ42 levels were mainly measured by Invitrogen amyloid-β human ELISA Kit (Thermo Fisher, KHB3481 and KHB3441) as per the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... and IL-2 Human Uncoated ELISA Kit (88-7025, Invitrogen) were used according to the manufacturer’s protocol and the signal was obtained in a microplate reader (Sunrise ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were analyzed using Human RANTES ELISA Kit (ThermoFisher, EHRNTS) and IL-1RA Human ELISA Kit (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: The IL-6 Receptor (Soluble) Human ELISA Kit (Invitrogen; BMS214) was used to quantify soluble IL-6Ra expression in cell culture media ...
-
bioRxiv - Immunology 2019Quote: ... and human/mouse TGF beta 1 ELISA Ready-SET-Go! Kit (2nd Generation; Affymetrix, eBioscience), respectively ...