Labshake search
Citations for Thermo Fisher :
1 - 50 of 8942 citations for Hrms Rapid Pcb Screening Calibration Solution Cs0.05 Unlabeled 13C12 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2019Quote: ... Mass calibration was performed using standard calibration solution (Thermo Scientific) prior to injection of the samples ...
-
bioRxiv - Biochemistry 2019Quote: ... The mass error was kept below 5 ppm by routinely calibrations on both polarities with a calibration solution (Pierce™ LTQ ESI calibration solutions, ThermoFisher). TLE from spat were resuspended in 3:1 methanol ...
-
ALiCE®: A versatile, high yielding and scalable eukaryotic cell-free protein synthesis (CFPS) systembioRxiv - Biochemistry 2022Quote: ... Instrument calibration was performed using Pierce FlexMix Calibration Solution (Thermo Fisher Scientific). The possible glycopeptides were identified as sets of peaks consisting of the peptide moiety and the attached N-glycan varying in the number of HexNAc units ...
-
bioRxiv - Microbiology 2023Quote: ... Mass spectrometer calibration was performed using the Pierce FlexMix calibration solution (Thermo Scientific). MS data acquisition was carried out utilizing the Xcalibur v ...
-
bioRxiv - Microbiology 2023Quote: ... External calibration was performed using LTQ ESI Negative Ion Calibration Solution (Thermo Scientific). The generated mass spectra were processed using Compound Discoverer 3.2 (Thermo Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... Calibration was performed with Pierce LTQ Velos ESI Positive Ion Calibration Solution (ThermoFisher). The MS was operated with the following parameters ...
-
bioRxiv - Plant Biology 2023Quote: ... External calibration was performed using LTQ ESI Positive/Negative Ion Calibration Solution (Thermo Scientific). Generated mass spectra were processed using Compound Discoverer 3.2 (Thermo ...
-
bioRxiv - Molecular Biology 2022Quote: ... Calibration was performed prior to analysis using the PierceTM FlexMix Ion Calibration Solutions (Thermo Fisher Scientific). Integrated peak areas were then extracted manually using Quan Browser (Thermo Fisher Xcalibur ver ...
-
bioRxiv - Immunology 2022Quote: ... Calibration was conducted prior to analysis using the PierceTM FlexMix Ion Calibration Solutions (Thermo Fisher Scientific). Integrated peak areas were then extracted manually using Quan Browser (Thermo Fisher Xcalibur ver ...
-
bioRxiv - Molecular Biology 2023Quote: ... Calibration was performed prior to analysis using the PierceTM FlexMix Ion Calibration Solutions (Thermo Fisher Scientific). Integrated peak areas were then extracted manually using Quan Browser (Thermo Fisher Xcalibur ver ...
-
Circadian rhythms in the gut microbiota shape sex differences in host gene expression and metabolismbioRxiv - Systems Biology 2023Quote: ... Calibration was performed prior to analysis using the PierceTM FlexMix Ion Calibration Solutions (Thermo Fisher Scientific). Integrated peak areas were then extracted manually using Quan Browser (Thermo Fisher Xcalibur ver ...
-
bioRxiv - Cancer Biology 2023Quote: ... Calibration was performed prior to analysis using the PierceTM FlexMix Ion Calibration Solutions (Thermo Fisher Scientific). Integrated peak areas were then extracted manually using Quan Browser (Thermo Fisher Xcalibur ver ...
-
bioRxiv - Cell Biology 2021Quote: ... Accucheck counting beads (Thermo Fisher, PCB-100) were added according to the manufacturer’s protocol prior to acquisition ...
-
DIFFERENTIAL BIOENERGETICS IN ADULT RAT CARDIOMYOCYTES ISOLATED FROM THE RIGHT VERSUS LEFT VENTRICLEbioRxiv - Cell Biology 2020Quote: ... Calibration was performed prior to analysis using the Pierce™ FlexMix Ion Calibration Solutions (Thermo Fisher Scientific). For specific analytes ...
-
Persistent DNA damage rewires lipid metabolism and promotes histone hyperacetylation via MYS-1/Tip60bioRxiv - Cell Biology 2021Quote: ... Calibration was performed prior to analysis using the Pierce™ FlexMix Ion Calibration Solutions (Thermo Fisher Scientific). Integrated peak areas of known identity from in-house libraires were then extracted manually using Quan Browser (Thermo Fisher Xcalibur ver ...
-
Multi-Omic Analysis Reveals Disruption of Cholesterol Homeostasis by Cannabidiol in Human Cell LinesbioRxiv - Systems Biology 2021Quote: ... Calibration was performed prior to analysis using the PierceTM Positive and Negative Ion Calibration Solutions (Thermo Fisher). Acquired data was then converted from .raw to .mzXML file format using Mass Matrix (Cleveland ...
-
bioRxiv - Physiology 2023Quote: ... Calibration was performed prior to analysis using the PierceTM Positive and Negative Ion Calibration Solutions (ThermoFisher Scientific). Metabolomics raw data were processed using El-Maven (AGRAWAL et al ...
-
bioRxiv - Microbiology 2022Quote: HRM was performed using an HRM reagent (MeltDoctor HRM Master Mix; Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... was generated using an established low-pH model.7 Mid-log Mtb-lux was washed with PBS (1X) and transferred into PCB media: 1X phosphate-citrate buffer (PCB, composed of 0.2 M sodium phosphate (Fisher Scientific) with 0.1 M citric acid (Fisher Scientific ...
-
Multi-Omic Analysis Reveals Disruption of Cholesterol Homeostasis by Cannabidiol in Human Cell LinesbioRxiv - Systems Biology 2021Quote: ... Calibration was performed prior to analysis using the PierceTM Positive and Negative Ion Calibration Solutions (Thermo Fisher Scientific). Acquired data was then converted from raw to .mzXML file format using Mass Matrix (Cleveland ...
-
bioRxiv - Neuroscience 2023Quote: Calibration was performed prior to analysis using the PierceTM Positive and Negative Ion Calibration Solutions (Thermo Fisher Scientific) every 7 days ...
-
bioRxiv - Developmental Biology 2023Quote: ... Calibration was performed prior to analysis using the PierceTM Positive and Negative Ion Calibration Solutions (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2024Quote: ... Calibration was performed prior to the run using the PierceTM Positive and Negative Ion Calibration Solutions (Thermo Fisher). Run order of samples was randomized and technical replicates were injected after every 4 samples to assess quality control ...
-
bioRxiv - Microbiology 2020Quote: ... the MS was calibrated using ESI Positive Ion Calibration Solution (P/N 88323) and ESI Negative on Calibration Solution (P/N 88324, Thermo Scientific, San Jose, USA). Fragmentation data for compound annotation were obtained using data-dependent MS/MS analysis by selecting the top four most intense ions per cycle ...
-
bioRxiv - Genetics 2023Quote: ... Calibration was performed prior to analysis using the Pierce™ Positive and Negative Ion Calibration Solutions (Thermo Fisher Scientific).
-
bioRxiv - Biochemistry 2023Quote: ... Calibration was performed prior to analysis using the Pierce™ Positive and Negative Ion Calibration Solutions (Thermo Fisher Scientific).
-
bioRxiv - Biochemistry 2023Quote: ... Calibration was performed prior to analysis using the Pierce™ Positive and Negative Ion Calibration Solutions (Thermo Fisher Scientific). Calibration was performed prior to analysis using the Pierce™ Positive and Negative Ion Calibration Solutions (Thermo Fisher Scientific).
-
bioRxiv - Cancer Biology 2023Quote: ... the MS instrument was calibrated using calibration solution (FlexMix, Thermo Fisher). Cell or tissue samples along with blank controls were placed in the autosampler ...
-
bioRxiv - Neuroscience 2024Quote: ... Anisole 99% (∼99% Acros Organics). These odors were previously confirmed to be saliently balanced in both sexes21.
-
bioRxiv - Neuroscience 2021Quote: ... The instrument was calibrated with positive and negative ion calibration solutions (ThermoFisher). Each sample was analyzed in positive and negative modes with m/z range 100 to 700 ...
-
bioRxiv - Neuroscience 2023Quote: ... calibration utilized a Calcium Calibration Buffer Kit (ThermoFisher) containing buffer solutions with free calcium concentrations ranging from 0 to 39 μM with a mix of K2-egtazic acid (EGTA) ...
-
bioRxiv - Biophysics 2019Quote: ... unlabeled COS-7 cells and adding 500 μL of beads solution (10720, Thermo Fisher) diluted at 5.10−7 in PBS during 5 minutes for beads to deposit before removing the solution and replacing it with PBS + 5% glucose ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 120 μL of 250 mM Hydroquinone solution (Acros Organics, 99%). Next ...
-
bioRxiv - Biophysics 2020Quote: ... calibrated using Pierce™ LTQ ESI Positive Ion Calibration Solution (Thermo Scientific, Germany). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... calibrated using Pierce™ LTQ ESI Positive Ion Calibration Solution (Thermo Scientific, Germany). Briefly ...
-
bioRxiv - Genomics 2023Quote: ... The instrument was externally calibrated using Pierce FlexMix Calibration Solution (Thermo Fisher Scientific), and the internal calibration feature (EASY-IC ...
-
bioRxiv - Microbiology 2021Quote: HPLC-HRMS (Accella 600 Thermo Scientific) was used to determine molecular weights of the Monascus pigments ...
-
bioRxiv - Neuroscience 2023Quote: ... and unlabeled Streptavidin (Life Technologies) were used at 2 μg/mL ...
-
bioRxiv - Bioengineering 2022Quote: ... and the solution was precipitated into cold (4°C) acetone (>99%, Fisher Scientific). The precipitate was spun down and re-dissolved into DI water ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... using MeltDoctor HRM Master Mix (Applied Biosystems) according to the manufacturer protocol in 10 μL reaction volume and using EwD/EwE primers developed by (Bienert et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... MeltDoctor HRM Mastermix (Applied Biosystems™, 4415440) were added to 10 µL PCR mix and fluorescence was detected using StepOnePlus™ Real-Time PCR System (Applied Biosystems™ ...
-
bioRxiv - Genetics 2024Quote: ... 10μl of MeltDoctor HRM Mastermix (ThermoFisher#4415440), 1μl of forward and 1μl of reverse primers (10μM ...
-
bioRxiv - Biophysics 2024Quote: ... Calibration measurements were performed with solutions of Alexa Fluor 488 (Life Technologies, Carlsbad, CA, USA), which has a known diffusion coefficient D = 435 μ m2/s at 22.5 °C (91) ...
-
bioRxiv - Microbiology 2021Quote: ... 30 µM of unlabeled CTP (ThermoFisher), and 1.5 μM of 22-bp parS DNA duplex in the binding buffer [100 mM Tris pH 8.0 ...
-
bioRxiv - Immunology 2024Quote: ... or unlabeled glucose (Thermo Fisher Scientific) were then added to generate a culture with a final concentration of 5mM Lactate and 10mM glucose ...
-
bioRxiv - Genomics 2019Quote: ... and resuspended in 48 μL DNA ligase solution (1× rapid ligation buffer (Thermo Scientific), 3 μM NN-adapter (a duplex of 5’-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATC ATT-3’ and 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT CTNN-3’ where N designates any base) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... All solutions were filtered using a 0.2 μm filter (Nalgene Rapid Flow, Thermo Scientific). Upon whole cell configuration ...
-
bioRxiv - Zoology 2023Quote: ... with MeltDoctor HRM Master Mix (Thermo Fisher Scientific) to perform HRM analysis ...
-
bioRxiv - Neuroscience 2021Quote: ... The series was established by blending two solutions from a Ca2+ calibration kit (Cat.No. C3008MP; Invitrogen); a low Ca2+ solution (10 mM K2EGTA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The ESI source was calibrated daily with a manufacturer’s calibration solution (Thermo Fisher Scientific, Bremen, Germany). Capillary and auxiliary gas temperatures of 380 °C ...