Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Cow Eukaryotic Translation Initiation Factor 1 EIF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and the murine housekeeping gene eukaryotic translation elongation factor-1α (EF1a; assay ID: VB1-14428-VT, Affymetrix, Inc.), that shares 95% sequence identity with the Syrian hamster ...
-
bioRxiv - Microbiology 2021Quote: ... in vitro synthesized guide RNA (sgRNAs) that were designed to cut shortly after the translation initiation codon in Ajuba Exon 1 were ordered from ThermoFisher’s sgRNA service (CCGGAGTCCGAGAGTCTCAACTT) ...
-
bioRxiv - Cancer Biology 2021Quote: Hypoxia-inducible factor 1-alpha (HIF-1α) was evaluated using a HIF-1 Alpha ELISA Kit (Invitrogen™). Procedure steps were followed according to the manufacturer’s instructions and results were monitored at 450 nm using a microplate reader (iMARK™ ...
-
bioRxiv - Plant Biology 2022Quote: The 5 kbp putative promoter fragment upstream of the translation initiation codon of each gene was cloned into pENTR4 dual-selection vector (Thermo Fisher SCIENTIFIC, USA) using an In-Fusion HD cloning kit ...
-
bioRxiv - Physiology 2024Quote: ... Initiation media contained 1% bovine serum albumin (Thermofisher™, B14) ...
-
bioRxiv - Molecular Biology 2022Quote: ... with 10% Fetal Cow Serum FCS (Eurobio) and 1% Penicillin/Streptomycin (Gibco). For cell counting ...
-
bioRxiv - Molecular Biology 2019Quote: ... for unperturbed samples or RiboMinus Eukaryotic Kit v2 (ThermoFisher, A15020) for PlaB/DMSO samples ...
-
bioRxiv - Pathology 2020Quote: ... Eukaryotic 18S rRNA (Life Technologies) and 28S (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... Eukaryotic 18S rRNA (Life Technologies) was endogenous control for normalization of the target RNAs.
-
bioRxiv - Molecular Biology 2024Quote: ... total RNA was used after ribodepletion (Ribominus eukaryotic kit v2; ThermoFisher) and fragmentation (25 min at 94 °C in 2X T4 PNK reaction buffer from NEB –140 mM Tris-HCl pH 7.6 ...
-
bioRxiv - Cell Biology 2022Quote: In vitro translation was performed using the One Step In Vitro Translation Kit (Thermo Scientific). Target proteins were cloned into pT7CFE1-NHA vector (with N-terminal HA tag ...
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA was depleted using the eukaryotic Ribo-minus kit (Ambion, A15017). Ligation of 5’ linker ...
-
bioRxiv - Microbiology 2020Quote: ... eukaryotic 18S assay (Hs99999901_s1, Applied Biosystems, Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... using nick translation kit (Molecular Probes, Cat# AF594). The samples were denatured 90 °C for 12 min ...
-
bioRxiv - Microbiology 2022Quote: IL-8 and IL-1β cytokines were quantified by ELISA using the Rabbit IL-1 beta ELISA Kit and Rabbit IL-8 ELISA Kit (Invitrogen). Aliquots of 2 mL of lung homogenate shred in saline solution were centrifuged during 30 min at 10 000 rpm and 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... SASP factors: human IL-8 Uncoated ELISA (88-8086-88, Invitrogen), human IL-6 Uncoated ELISA (88-7066-88 ...
-
bioRxiv - Bioengineering 2023Quote: The following enzyme-linked immunoassay (ELISA) kits were used to analyze secreted factors: IL-18 (BMS267-2, Thermofisher) and IL-8 (D8000C ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... interleukin-6 and -8 (IL-6 and IL-8) human Instant Elisa™ kits and matrix metalloproteinase-1 (MMP-1) human Elisa kit from ThermoFisher Scientific.
-
bioRxiv - Cell Biology 2019Quote: ... Meiosis was induced at initiation of experiment by addition of 1-methyladenine (1-MA, 10 μM, Acros Organics). NEBD normally started at 20-25 minutes after 1-MA addition.
-
bioRxiv - Evolutionary Biology 2020Quote: Cells in 6-well plates were transfected with 1 ug human or cow CD44-promoter-pNL2.1 or empty vector pNL2.1 using Lipofectamine 3000 (Invitrogen) as manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Translation activity at the midbody was assessed by detecting protein synthesis level using an L-HPG-translation kit (ThermoFisher, Cat# C10429) as previously described 44 ...
-
bioRxiv - Immunology 2020Quote: ... The following ELISA kits were used: IL-1β Mouse ELISA kit (ThermoFisher), IL-18 Mouse ELISA kit (ThermoFisher) ...
-
bioRxiv - Genomics 2022Quote: Mammalian in vitro translation system (Thermo Fisher Scientific IVT Kit #88330) was used to synthesize GST-HA-His protein as described by the manufacturer ...
-
bioRxiv - Cancer Biology 2022Quote: ... using ELISA kits (Invitrogen) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... commercial ELISA kits (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... ELISA kits by Invitrogen (mouse Aβ42 ...
-
bioRxiv - Biochemistry 2020Quote: ... after which GeneChip eukaryotic poly-a RNA controls (Affymetrix) were added to each fraction ...
-
bioRxiv - Microbiology 2020Quote: ... Eukaryotic cell culture media RPMI 1640 (Thermo Fisher Scientific) was supplemented with 10% LB (R10LB) ...
-
bioRxiv - Plant Biology 2020Quote: ... 18S rRNA (Eukaryotic 18S rRNA Endogenous Control, Applied Biosystems) and LdSmt3 (Petek et al ...
-
bioRxiv - Neuroscience 2024Quote: ... and Hs99999901_s1 (Eukaryotic 18s rRNA, VIC-MGB, ThermoFisher #4331182). The cycling process was carried out using the Roche LightCycler 480II ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 ng firefly luciferase plasmid and 112.5 ng GFP or different eIF1 plasmids using Lipofectamine 2000 (Thermo Fisher). After 24 hours ...
-
bioRxiv - Immunology 2019Quote: ... IL-1 alpha Mouse Uncoated ELISA Kit (ThermoFisher #88-501988); eBioscience Mouse IL-6 ELISA Ready-SET-Go! Kit (Fisher Scientific #50-112-8863 ...
-
bioRxiv - Immunology 2020Quote: ... IL-23 and tumor necrosis factor alpha (TNF-α) were quantified in lung tissue lysates and BAL using commercial ELISA kits (Invitrogen, San Diego ...
-
bioRxiv - Cell Biology 2022Quote: ... WSTF and SNF2H cDNA were cloned into the in vitro translation (IVT) vectors for in vitro translation (1-Step IVT Systems, Thermo Fisher) and lentiviral/retroviral vectors for stable expression ...
-
bioRxiv - Cancer Biology 2021Quote: ... Equal amounts of conditioned media were analyzed by ELISA (IL-1 beta Human ELISA Kit, Thermofisher KHC0011), using manufacturer protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... ELISAs were performed using FBLN5 (Fibulin-5) Human ELISA Kit from Fine Test (EH0772) and Thrombospondin 1 (TSP1) Human ELISA Kit from Invitrogen (BMS2100), following the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... These constructs were then used for in vitro translation using a HeLa cell lysate-based Kit (1-Step Human Coupled IVT Kit—DNA, 88881, Life Technologies). The in vitro-translated proteins were then purified using His Pur cobalt spin columns (Thermo Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Eukaryotic 18S rRNA was then minimised using both the RiboMinus plant and eukaryote kits (Invitrogen, Carlsbad, USA) according to the manufacturer’s protocols ...
-
bioRxiv - Pathology 2021Quote: ... For expression in eukaryotic cells the pcDNA™ 3.1/V5-His TOPO® TA Expression Kit (Invitrogen) was used according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: mMCPT-1 was detected using the MCPT-1 mouse uncoated ELISA kit (ThermoFisher) following the protocol provided by manufacturer ...
-
bioRxiv - Immunology 2019Quote: ... using Uncoated ELISA Kits (Invitrogen) for TNF-α ...
-
bioRxiv - Immunology 2020Quote: ... using Uncoated ELISA Kits (Invitrogen) for TNF-α ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Immunology 2024Quote: ... and ELISA analysis (human IL-1β ELISA Kit, Thermo Fisher Scientific) according to the manufacturer ‘s instructions.
-
bioRxiv - Immunology 2021Quote: ... IL-2 Human Uncoated ELISA kit and IFNγ Human Uncoated ELISA kit (both from Invitrogen) and DuoSet Human IFN-gamma kit and Ancillary Reagent Kit 2 (R&D Systems ...
-
bioRxiv - Pathology 2022Quote: ... Aβ42 human ultrasensitive ELISA Kit and Tau (phospho) [pT231] human ELISA Kit from Thermo Fisher, and sAPPα and sAPPβ ELISA Kit from Mybiosource ...
-
bioRxiv - Plant Biology 2021Quote: ... and digoxigenin 11-dUTP (35S) with a Nick Translation kit (Invitrogen - Oregon, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... with the Mouse Monocyte Chemoattractant Protein-1/CCL2 (MCP-1) Uncoated ELISA Kit (ThermoFisher) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... qPCR mastermix was made with Eukaryotic 18S rRNA Endogenous Control (ThermoFisher), Universal Master Mix (Taqman ...
-
bioRxiv - Neuroscience 2019Quote: ... elegans and directionally cloned into the eukaryotic expression vector pcDNA3.1 (Invitrogen).