Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Coiled Coil Domain Containing 28B CCDC28B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... and coiled-coil domains through an LR reaction (ThermoFisher) into the moss expression construct ...
-
bioRxiv - Cell Biology 2023Quote: The codon optimized DNA of coiled-coils were synthesized (Invitrogen) and cloned into pGEX-6P-1 vectors (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2022Quote: ... by removing the coiled-coil domain CC-Di using polymerase chain reaction (PCR) via Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific, Waltham, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Charged residues within the coiled-coil region were replaced with alanine by splice overlap PCR mutagenesis using Accuprime pfx polymerase (Invitrogen). PCR products containing the alanine mutation were cloned under the control of the ara promoter by insertion into pBAD33 by digestion with Kpn1 (NEB ...
-
bioRxiv - Genetics 2021Quote: ... transferred to PVDF membranes and probed with anti-CCDC28B (Invitrogen, 1/1000) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... or deleted CC (coiled-coiled) version of Bik-1 with an HA tag was inserted into the pcDNA3.1(+) backbone (Invitrogen: V79020). HEK293T cells were transfected with Lipofectamine™ 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... The pET-28b clone was expressed in Rosetta (DE3) Escherichia coli cells (Invitrogen). The cells were grown to mid log phase ...
-
bioRxiv - Biochemistry 2024Quote: Construct containing Avi-tagged HormR/GAIN domains of ADGRL3 was expressed in High Five cells (Thermo Fisher, B85502) grown in Insect-Xpress medium (Lonza ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse monoclonal antibody generated against the C-terminal domain of N-cadherin (Invitrogen; 1:500); anti-CRB1 (a kind gift of Dr ...
-
bioRxiv - Cell Biology 2021Quote: ... and then sub-cloned into pET-28b expression vector using NcoI and XhoI restriction sites (Thermo Scientific). The pET-28b clone was expressed in Rosetta (DE3 ...
-
bioRxiv - Immunology 2022Quote: ... The gB Domain I and Domain I+II were purified using Nickel-NTA resin (Thermo Fisher Scientific), and the gB Domain II was purified with lectin resin (VWR.)
-
bioRxiv - Genetics 2022Quote: ... and cloned into the pDEST32 vector containing the GAL4 DNA binding domain (DBD) through Gateway cloning (ThermoFisher, 11789020 and 12538120) and used as the Y2H bait construct ...
-
bioRxiv - Immunology 2021Quote: DNA constructs encoding anti-SCARB2 antibody heavy and light chain variable domains (clone JL278) were synthesized (ThermoFisher) and cloned into mammalian expression vectors containing a mouse IGHV signal peptide and IgG1 constant regions ...
-
bioRxiv - Genetics 2022Quote: ... elegans genes was cloned into the pDEST22 vector containing the GAL4 activating domain (AD) using the CloneMinerTM cDNA library construction kit (ThermoFisher, A11180). A forward Y2H library screen was performed using the ProQuest Two-Hybrid System (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... This oligo was annealed and amplified to a fixed 91nt oligo containing the scaffold domain using Taq polymerase (Invitrogen, Cat. #10342046). Transcription was performed using Hi-SCribe T7 ...
-
bioRxiv - Microbiology 2021Quote: ... NPC1 C domain and NPC1 I domain) and the viral protein constructs were co-transfected using Lipofectamine 2000 (Invitrogen) following the manufacture instructions.
-
bioRxiv - Biophysics 2020Quote: Wild-type PSD-95 PDZ3-SH3-GK (PSG), PDZ3 domain and mutants (all pseudo, engineered F337W in PDZ3 domains) are encoded in modified pRSET vector (Invitrogen) and transformed in Escherihia coli BL21(DE3 ...
-
bioRxiv - Immunology 2021Quote: The COVID-19 receptor-binding domain (RBD) and the N-terminal peptidase domain of human ACE2 were expressed using HEK293F cells (Invitrogen). The COVID-19 RBD (residues Arg319-Phe541 ...
-
bioRxiv - Developmental Biology 2020Quote: ... A pMA-T vector encoding for a DNA in which the DSG domain of Arpp19 sequence was exchanged by the cassette domain (D2-D1 mutant) was synthesized by Geneart (Thermofisher) and sub-cloned into Pet-15 6his vector.
-
bioRxiv - Immunology 2022Quote: ... AD-2 domain site 1 (Life Technologies Corporation), Domain I ...
-
bioRxiv - Microbiology 2020Quote: ... Meso Scale Discovery (MSD)) were coated with mouse anti-human IgG antibody (CH2 domain, cat# MA5-16929, ThermoFisher Scientific) at 2 μg/mL in 1X PBS (50μL/well) ...
-
bioRxiv - Neuroscience 2022Quote: ... using a commercial human fetal brain cDNA library containing cDNAs fused to the gal4 activation domain of pEXP-AD502 (ProQuest™, ThermoFisher Scientific, USA), as prey ...
-
bioRxiv - Biochemistry 2020Quote: ... different domains or subunits of the Spike protein and the extracellular domain of ACE2 were produced in Expi293F cells (Thermo Fisher Scientific). Expi293F cells were cultured at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Qi33,65–67 and was used since it can recognize SEL1L without its FN2 domain) was applied at 1:100 dilution followed by secondary antibody conjugated to Alexa Fluor 488 or 594 (Invitrogen) at 1:100 ...
-
bioRxiv - Immunology 2020Quote: The Fab fragments for anti-SARS-CoV-2 antibodies ION_300 and ION_360 and SARS-CoV-2 receptor binding domain (RBD) were expressed in Expi293F™ cells (Thermo Fisher, A14527). The antibody:RBD complexes were mixed and co-purified by size exclusion chromatography in 20 mM Tris-HCl (pH 7.5 ...
-
bioRxiv - Microbiology 2023Quote: ... directed against the cytoplasmic domain of E-cad and revealed using an anti-mouse IgG (H+L) secondary antibody (Alexa Fluor 555) (Life Technologies). The 4’,6’-diamino-2-fenil-indol (DAPI ...
-
bioRxiv - Cell Biology 2023Quote: ... to detect HA-tagged TRPM2 channel domain and the lower part of the membrane was incubated with rabbit-anti-FLAG (DYKDDDDK) antibody (1:1000; 701629; Invitrogen, USA) to detect FLAG-tagged NUDT9H domain and NUDT5 ...
-
bioRxiv - Cell Biology 2023Quote: ... 50 µl of a 1:100 dilution of the AF488 goat anti-alpaca secondary antibody was used (Jackson Immunoresearch 0.25MG Alexa Fluor 488-AffiniPure Goat Anti-Alpaca IgG, VHH domain, from Fisher Scientific). For all cases ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 μM DDR1 (Fisher Scientific, discoidin domain receptor 1 inhibitor). Time lapse images were acquired every 10 minutes for 24 hours.
-
bioRxiv - Genomics 2024Quote: ... and NRG1 EGF-like domain (ThermoFisher; MA4-12896, 1:100). Slides were incubated for 1 hour at room temperature with primary antibodies diluted in 1x Opal blocking/antibody diluent (Akoya biosciences) ...
-
bioRxiv - Physiology 2022Quote: ... A third water bath where temperature was regulated via an aluminium coil pumping chilled water (Thermo Fisher Scientific, EK20 immersion cooler, USA) was used to keep water temperature in the chambers near 21°C (actual range ...
-
bioRxiv - Molecular Biology 2021Quote: ... Co-purification of 6His-tagged PGC-1α protein domains was detected by western blot using anti-6His antibody (clone His.H8, ThermoFisher Scientific MA1-21315).
-
bioRxiv - Cell Biology 2024Quote: ... Antibody-mediated inhibition of hNR-EVs was performed with a commercial antibody that recognizes an extracellular topological domain of PLP1 at its N terminus (AA 36 to 85, Invitrogen, PA5-40788) incubating hNR-EVs with anti-PLP1 1.25 ug/ml for 15 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... NC1 domain was digested with trypsin (MS Grade, Thermo Fisher Scientific) overnight at 37 °C and then analyzed by LC-MS analysis on a Shimadzu UFLC 20ADXR HPLC system in-line with an AB Sciex 5600 Triple TOF mass spectrometer (AB SCIEX ...
-
bioRxiv - Microbiology 2021Quote: ... The presence of recombinant virus was verified by immunostaining with monoclonal antibody against the nucleoprotein (FujiRebio, Cat# 800-092) and polyclonal antiserum against the S1 domain (Thermo Fisher, Cat# PA581798). The filtered virus was then used to inoculate VERO cells seeded in Cellstack Culture Chambers (Corning ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana TF fused to Gal4 activation domain within pDEST™22 (Invitrogen) constructs in S ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The ET domain was further purified using Nickel-NTA resin (Thermo Scientific) to remove the cleaved tag ...
-
bioRxiv - Plant Biology 2019Quote: ... Kinase domain OsWAKL21376-725 was cloned into bacterial expression vector pDEST17 (Invitrogen) and transformed into E ...
-
bioRxiv - Immunology 2022Quote: ... These gB domain sequences were cloned into pcDNA3.1(+) mammalian expression vector (Invitrogen) and transiently transfected into Expi293F™ cells for five days ...
-
bioRxiv - Molecular Biology 2021Quote: ... antibodies and mounted using DAPI-containing Prolong Diamond (Life Technologies). To quantify apoptosis ...
-
bioRxiv - Immunology 2023Quote: ... and incubated with an antibody staining mix containing DAPI (ThermoFisher) viability dye diluted in PBS for 20 minutes at 4 °C.
-
bioRxiv - Immunology 2020Quote: ... and purified using Nickel-NTA resin for gB Domain II (Thermo Fisher Scientific), and lectin resin (VWR ...
-
bioRxiv - Biochemistry 2022Quote: ... A mixture containing 20µL LUV and 8µg anti-FITC antibody (Thermofisher) was prepared ...
-
bioRxiv - Immunology 2021Quote: ... The extracellular domain of NKp46 was cloned into pcDNA Myc-His 3.1a vector (Invitrogen) or pCMV vector (Addgene plasmid #59314 ...
-
bioRxiv - Biochemistry 2022Quote: 5 μM purified PWWP domain was incubated with 5× SYPRO Orange (Thermo Fisher Scientific) in assay buffer (20 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2021Quote: ... the N-terminal domain MLKL154 and MLKL139 were cloned into pcDNA3.1 vector (Life Technologies) as previously described [33] ...
-
bioRxiv - Immunology 2023Quote: ... and an ICAM1 exon 2 (Ig domain 1)-targeting TrueGuide sgRNA (Invitrogen; sequence: CCACAGTTCTCAAAGCACAG) according to the manufacturer’s U2OS protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... and a drop of PBS containing secondary antibody (anti-rabbit IgG antibody–Alexa Fluor 568 conjugate; Invitrogen) was added ...
-
bioRxiv - Neuroscience 2023Quote: ... a secondary antibody solution containing a secondary antibody conjugated to Alexa Fluor 594 fluorophore (1:500; Invitrogen) was added to the sections and incubated for 1 h at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... Antibodies were diluted in Infection Media containing DMEM with glutamine (Life Technologies), 0.7% Low IgG BSA (Sigma) ...