Labshake search
Citations for Thermo Fisher :
1 - 50 of 2829 citations for Clostridium Difficile Toxoid B since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The mixture remained for 60 minutes at room temperature before being inoculated on Cycloserine-cefoxitin fructose modified agar (CCFA) (Remel™) or Clostridium difficile Selective Agar (BBL™) and Columbia CNA agar (Thermo Fisher Scientific Remel Products). Inoculated plates and broth were incubated in BD Gas-Pak™ EZ container systems with BD BBL™ CO2 generators and BD BBL™ Gas Pak™ anaerobic CO2 indicators (Franklin Lakes ...
-
bioRxiv - Immunology 2022Quote: ... and Clostridium histolyticum collagenase (ThermoFisher Scientific) used as positive controls ...
-
bioRxiv - Microbiology 2020Quote: ... difficile Test kit (Oxoid Limited, Thermo Scientific, Perth, UK). C ...
-
bioRxiv - Microbiology 2020Quote: ... difficile selective agar (Oxoid Limited, Thermo Fisher Scientific, Perth, UK) and incubated under anaerobic conditions for 48-72 hours ...
-
bioRxiv - Microbiology 2020Quote: ... difficile spores suspended in 50 µl of distilled water (Gibco) or mock-challenged with water vehicle ...
-
bioRxiv - Epidemiology 2019Quote: ... difficile colony was diluted in 15μL UltraPure Water (Invitrogen 10977-015), heated to 95°C for 20 min and then used for colony PCR to determine identity and toxin type of the isolated organism (26 ...
-
bioRxiv - Immunology 2020Quote: ... difficile spores suspended in 20-100 µl of distilled water (Gibco) or mock-infected with vehicle alone ...
-
bioRxiv - Immunology 2023Quote: ... difficile (106/condition) were stained with 5 μM Syto9 (Thermo Fisher Scientific, #S34854) in 0.9% NaCl for 30 min at RT ...
-
bioRxiv - Microbiology 2020Quote: ... difficile spores previously stained with Alexa Fluor 488 Protein Labeling Kit (Molecular Probes, USA) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2019Quote: ... difficile frozen stocks were cultured on TBHI (Brain heart infusion, Fisher Scientific, PA, USA) supplemented with 100 mg/L L-cysteine (Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... difficile (106/condition) were stained with 5 μM SYTO9 dye (Thermo Fisher Scientific, MA, USA) in 0.9% NaCl for 30 min at RT ...
-
bioRxiv - Epidemiology 2019Quote: ... difficile by Maldi-TOF MS identification and/or RapID™ ANA II System (ThermoFisher Scientific, USA). Confirmed isolates of C ...
-
bioRxiv - Microbiology 2021Quote: ... difficile by Maldi-TOF identification and/or RapID ANA II System (Thermo Fisher Scientific Remel Products).
-
bioRxiv - Microbiology 2021Quote: ... difficile spore IgY batch 7246 (AvesLab, USA) and 1:150 phalloidin Alexa-Fluor 568 (A12380 Invitrogen, USA); in PBS–3% BSA overnight at 4° C ...
-
bioRxiv - Microbiology 2020Quote: ... difficile infection by treating mice with 0.5 mg/mL cefoperazone (MP Pharmaceuticals) in sterile distilled drinking water (Gibco) ad libitum ...
-
bioRxiv - Immunology 2020Quote: ... difficile infection by placing mice on 0.5 mg/mL cefoperazone (MP Pharmaceuticals) in sterile distilled drinking water (Gibco) ad libitum ...
-
bioRxiv - Immunology 2021Quote: The RBDwt protein was conjugated to Cucumber mosaic virus - tetanus toxoid (CuMVTT) using the linker Succinimidyl 6-(beta-maleimidopropionamido) hexanoate (SMPH) (Thermo Fisher Scientific, Waltham, USA). CuMVTT contains a powerful T cell epitope of the Tetanus toxin (TT ...
-
bioRxiv - Bioengineering 2020Quote: ... 3) latrunculin-b (Lat-B; 2 μM; Fisher Scientific), 4 ...
-
bioRxiv - Microbiology 2022Quote: ... difficile was PCR-amplified (forward primer: ATGTGTAGTGAACAAAAATTTTTTATATGT, reverse primer: CAGTTCAGCCTTCCATAATCCATG) and TA cloned into the expression plasmid pTrcHis2 TOPO (Thermofisher, Carlsbad CA, USA), in-frame with the C-terminal myc-6XHis and Myc tags ...
-
bioRxiv - Developmental Biology 2019Quote: ... 4 mL 50X B-27 without Vitamin B (Gibco 12587010) per 200 mL of DMEM (Invitrogen 11960-051 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 μg/ml Amphotericin B (Amp B, Thermo Scientific) was added to the medium from day 10 onwards ...
-
bioRxiv - Neuroscience 2019Quote: ... B-27 (Invitrogen), glucose ...
-
bioRxiv - Developmental Biology 2020Quote: ... B-27 (Invitrogen) and N2 (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... b-mercaptoethanol (Gibco), and human bFGF (10 ng/mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... B-27 (Gibco), 10mM HEPES solution (Millipore-Sigma) ...
-
bioRxiv - Bioengineering 2019Quote: ... pPICZα-B (Invitrogen) belongs to a family of K ...
-
bioRxiv - Immunology 2019Quote: ... Medium B (Invitrogen) was used to permeabilize PBMC and 0.1% saponin was used to permeabilize LN cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... B-27 (Gibco), HEPES solution (Millipore-Sigma) ...
-
bioRxiv - Molecular Biology 2021Quote: ... B-27 (Gibco), BSA (0.05% ...
-
bioRxiv - Cancer Biology 2022Quote: ... b-mercaptoethanol (Gibco), MEM NEAA (Gibco) ...
-
bioRxiv - Molecular Biology 2022Quote: ... B-27 (Gibco), BSA (0.05% ...
-
bioRxiv - Neuroscience 2023Quote: ... B-27 (Gibco), 10 ng/mL each of platelet-derived growth factor (PDGF ...
-
bioRxiv - Cell Biology 2023Quote: B-27 (Gibco) - 1x ...
-
bioRxiv - Neuroscience 2023Quote: ... Amphotericin B (Gibco) and the following morphogens at 20 ng/mL (Peprotech) ...
-
bioRxiv - Developmental Biology 2023Quote: ... B-27 (Gibco), N2 (Gibco) ...
-
bioRxiv - Molecular Biology 2024Quote: ... B-27 (Gibco), 0.05% BSA (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... Amphotericin B (ThermoFisher), recombinant human fibroblastic growth factor basic (FGF-2 ...
-
bioRxiv - Microbiology 2022Quote: ... B-lymphocytes were enriched using Dynabeads Untouched Human B Cells Kit (Invitrogen). Each sample was loaded into two lanes (i.e ...
-
bioRxiv - Immunology 2021Quote: ... B-Mercaptoethanol [55mM] (Gibco), Sodium Pyruvate [1mM] (Life Technologies) ...
-
bioRxiv - Neuroscience 2021Quote: ... B-27 (ThermoFisher #17504044) and GlutaMAX (ThermoFisher #35050061) ...
-
bioRxiv - Neuroscience 2021Quote: ... B-27 (Thermo Fisher), BDNF/GDNF (R&D Systems ...
-
bioRxiv - Cell Biology 2019Quote: ... cytochalasin-B (Thermo Fisher) was added to the final concentration of 6 μg/ml and samples were cultured for another 26 h ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 × B-27 (Gibco), 1.25 mM N-acetylcysteine (Sigma) ...
-
bioRxiv - Cell Biology 2019Quote: ... B-27 Supplement (Gibco), 1% penicillin/streptomycin (Gemini Bio-Products) ...
-
bioRxiv - Bioengineering 2020Quote: ... 2% B-27 (GIBCO), 1 mM sodium pyruvate MEM (GIBCO) ...
-
bioRxiv - Neuroscience 2021Quote: ... B-27 (Invitrogen, Italy) 2% and Gentamycin 5 µg/ml at 37°C in 5% CO2 up to 30 days in vitro (DIV) ...
-
bioRxiv - Neuroscience 2020Quote: ... Hygromycin B (Thermo Fisher) was used to select stable integrants which were propagated to generate the final cell line (Dox:GFP-0N4R P301L) ...
-
bioRxiv - Microbiology 2021Quote: ... in B-PER (ThermoFisher)] ...
-
bioRxiv - Systems Biology 2021Quote: ... 0.1% amphotericin B (Gibco) supplemented with 0.001% Insulin-transferrin (Gibco) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 55µM b-mercaptoethanol (Invitrogen), 1X non-essential amino acids (Invitrogen ...