Labshake search
Citations for Thermo Fisher :
1 - 18 of 18 citations for Clostridium Difficile Toxoid A since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The mixture remained for 60 minutes at room temperature before being inoculated on Cycloserine-cefoxitin fructose modified agar (CCFA) (Remel™) or Clostridium difficile Selective Agar (BBL™) and Columbia CNA agar (Thermo Fisher Scientific Remel Products). Inoculated plates and broth were incubated in BD Gas-Pak™ EZ container systems with BD BBL™ CO2 generators and BD BBL™ Gas Pak™ anaerobic CO2 indicators (Franklin Lakes ...
-
bioRxiv - Immunology 2022Quote: ... and Clostridium histolyticum collagenase (ThermoFisher Scientific) used as positive controls ...
-
bioRxiv - Microbiology 2020Quote: ... difficile Test kit (Oxoid Limited, Thermo Scientific, Perth, UK). C ...
-
bioRxiv - Microbiology 2020Quote: ... difficile selective agar (Oxoid Limited, Thermo Fisher Scientific, Perth, UK) and incubated under anaerobic conditions for 48-72 hours ...
-
bioRxiv - Microbiology 2020Quote: ... difficile spores suspended in 50 µl of distilled water (Gibco) or mock-challenged with water vehicle ...
-
bioRxiv - Epidemiology 2019Quote: ... difficile colony was diluted in 15μL UltraPure Water (Invitrogen 10977-015), heated to 95°C for 20 min and then used for colony PCR to determine identity and toxin type of the isolated organism (26 ...
-
bioRxiv - Immunology 2020Quote: ... difficile spores suspended in 20-100 µl of distilled water (Gibco) or mock-infected with vehicle alone ...
-
bioRxiv - Immunology 2023Quote: ... difficile (106/condition) were stained with 5 μM Syto9 (Thermo Fisher Scientific, #S34854) in 0.9% NaCl for 30 min at RT ...
-
bioRxiv - Microbiology 2020Quote: ... difficile spores previously stained with Alexa Fluor 488 Protein Labeling Kit (Molecular Probes, USA) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2019Quote: ... difficile frozen stocks were cultured on TBHI (Brain heart infusion, Fisher Scientific, PA, USA) supplemented with 100 mg/L L-cysteine (Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... difficile (106/condition) were stained with 5 μM SYTO9 dye (Thermo Fisher Scientific, MA, USA) in 0.9% NaCl for 30 min at RT ...
-
bioRxiv - Epidemiology 2019Quote: ... difficile by Maldi-TOF MS identification and/or RapID™ ANA II System (ThermoFisher Scientific, USA). Confirmed isolates of C ...
-
bioRxiv - Microbiology 2021Quote: ... difficile by Maldi-TOF identification and/or RapID ANA II System (Thermo Fisher Scientific Remel Products).
-
bioRxiv - Microbiology 2021Quote: ... difficile spore IgY batch 7246 (AvesLab, USA) and 1:150 phalloidin Alexa-Fluor 568 (A12380 Invitrogen, USA); in PBS–3% BSA overnight at 4° C ...
-
bioRxiv - Microbiology 2020Quote: ... difficile infection by treating mice with 0.5 mg/mL cefoperazone (MP Pharmaceuticals) in sterile distilled drinking water (Gibco) ad libitum ...
-
bioRxiv - Immunology 2020Quote: ... difficile infection by placing mice on 0.5 mg/mL cefoperazone (MP Pharmaceuticals) in sterile distilled drinking water (Gibco) ad libitum ...
-
bioRxiv - Immunology 2021Quote: The RBDwt protein was conjugated to Cucumber mosaic virus - tetanus toxoid (CuMVTT) using the linker Succinimidyl 6-(beta-maleimidopropionamido) hexanoate (SMPH) (Thermo Fisher Scientific, Waltham, USA). CuMVTT contains a powerful T cell epitope of the Tetanus toxin (TT ...
-
bioRxiv - Microbiology 2022Quote: ... difficile was PCR-amplified (forward primer: ATGTGTAGTGAACAAAAATTTTTTATATGT, reverse primer: CAGTTCAGCCTTCCATAATCCATG) and TA cloned into the expression plasmid pTrcHis2 TOPO (Thermofisher, Carlsbad CA, USA), in-frame with the C-terminal myc-6XHis and Myc tags ...