Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Centromere Protein O CENPO Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: O-GlcNAc modified proteins were labeled using Click-iT™ O-GlcNAc Enzymatic Labeling System (Thermo Fisher Scientific, Waltham, MA) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... were incubated O/N with 40 μls Protein G Dynabeads (Invitrogen) in 300 μls sterile 1xPBS + 0.02 % Tween and then washed 3x with IP lysis buffer ...
-
Salmonella actively modulates TFEB in murine macrophages in a growth-phase and time-dependent mannerbioRxiv - Cell Biology 2023Quote: ... or rabbit anti-Salmonella O antiserum group B antibodies (Fisher Scientific, ON) at 1:500 ...
-
Physiological activation of the nephron central command drives endogenous kidney tissue regenerationbioRxiv - Physiology 2021Quote: Global protein synthesis was assessed by O-propargyl-puromycin (OPP) labeling (Thermo Fisher Scientific) as described before (20) ...
-
bioRxiv - Biochemistry 2020Quote: Protein biosynthesis assays were carried out using the click-it plus O-propargyl-puromycin (OPP) protein synthesis assay (ThermoFisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... O-phenylenediamine dihydrochloride (ThermoFisher) was added to the plates and 1M sulfuric acid was added to stop color development ...
-
bioRxiv - Microbiology 2019Quote: ... The extracted protein was labeled with Click-iT™ O-GlcNAc Enzymatic Labeling System (Invitrogen, C33368) following with the manufacture’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... w/o glutamine (Gibco, 10829018), 20% KnockOut Serum Replacement (Gibco ...
-
bioRxiv - Biochemistry 2022Quote: ... Target protein was coated overnight (O/N) at 4 °C on MaxiSorp™ 96-well plates (Nunc). ELISA-blocking buffer (PBS containing 0.5% (w/v ...
-
bioRxiv - Developmental Biology 2023Quote: ... or the combination of Oregon green 488-conjugated anti-rabbit IgG antibody (O-11038, Invitrogen) and Cyanine 3-conjugated anti-mouse IgG antibody (M30010 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2’-O-MOE phosphoramidites (ThermoFisher Scientific) were prepared at 0.08 M concentration in dry acetonitrile ...
-
bioRxiv - Cancer Biology 2021Quote: ... B27 w/o vitamin A (Invitrogen), EGF (Peprotech ...
-
bioRxiv - Developmental Biology 2022Quote: O-propargyl-puromycin (OPP, Thermo Fisher) was dissolved in DMSO at 2 mg/ml stock and frozen at -20°C ...
-
bioRxiv - Microbiology 2022Quote: ... o-Phenylenediamine dihydrochloride (OPD) (ThermoFisher Scientific) substrate was then added at 100μl/well and incubated for 15 minutes for colour development ...
-
THE OLFACTORY RECEPTOR Olfr78 REGULATES DIFFERENTIATION OF ENTEROCHROMAFFIN CELLS IN THE MOUSE COLONbioRxiv - Cell Biology 2023Quote: ... and B27 w/o vit.A (Gibco), gentamycin ...
-
bioRxiv - Immunology 2021Quote: ... Substrate (OPD, O-phenylenediamine dihydrochloride, Thermo Scientific) was added ...
-
bioRxiv - Developmental Biology 2019Quote: ... N2 and B27 w/o vit.A (Invitrogen), gentamycin ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... then incubated in Sytox-O (Invitrogen: S34861), which labels cellular nuclei ...
-
bioRxiv - Neuroscience 2021Quote: ... OGB1-AM (O-6807, Invitrogen, 50 μg) was first dissolved in 4 μl of 20% pluronic in DMSO (F-127 ...
-
bioRxiv - Developmental Biology 2024Quote: ... anti-O-GlcNAc clone HGAC85 (ThermoFisher #HGAC85), anti-CDX2 (abcam #ab76541) ...
-
bioRxiv - Developmental Biology 2024Quote: ... B27 w/o vitamin A (Life Technologies), N2 (Life Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... at 4°C o/n and then with 40 μL of pre-blocked (1 mg/ml BSA) Dynabeads protein A (ThermoFisher). Beads were sequentially washed with Wash buffer 1 (20 mM Tris HCl pH 8.1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... in RPMI media (w/o FBS) (Invitrogen, USA) was used for transfection ...
-
bioRxiv - Microbiology 2022Quote: ... 500 μL of o-xylene (Fisher Scientific; AAA11358AP) was added to each sample ...
-
bioRxiv - Immunology 2020Quote: ... and the rabbit Listeria O antisera (ThermoFisher, DF2300). Secondary antibodies used (all from ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: 20 µM O-propargyl puromycin (OPP) (Invitrogen C10459) was used to label cells for 30 mins at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... O-propargyl-puromycin (OP-puro; 25 µM, Invitrogen) and thymidine (2 mM ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated with primary antibody O/N at 4°C (5% FBS, 0.5% Tx, 0.2% gelatine in PBS; GFP (1:500, ThermoFisher Scientific). Slices were then repeatedly washed with PBS-0.5% Tx ...
-
bioRxiv - Developmental Biology 2023Quote: ... the embryos were incubated O/N with an Alexa Fluor 488 anti-mouse IgG secondary antibody (Life Technologies, A28175) diluted at a final concentration of 1/200 respectively in 1% blocking solution ...
-
bioRxiv - Genetics 2021Quote: ... membranes were hybridized at 65°C overnight with denatured probes generated by Klenow-labeling of an Arabidopsis centromere 180 bp satellite fragment with α32P dATP (DecaLabel DNA Labeling Kit, Thermo Scientific). The fragment was prepared by PCR amplification of Arabidopsis genomic DNA using the primer combination CEN-1 ATCAAGTCATATTCGACTCCA and CEN-2 CTCATGTGTATGATTGAGAT ...
-
bioRxiv - Neuroscience 2022Quote: ... and immersed in Hanks’ Balanced Salt solution w/o ions (HBSS w/o Ca2+ and Mg2+; #14175-053, Thermo Fisher Scientific) on ice ...
-
bioRxiv - Microbiology 2023Quote: ... the cornea containing molten scaffold medium was placed epithelial side down in a 6 well-plate containing 400 µl of Ethylene glycol-O,O’-bis(2-aminoethyl)-N,N,N’,N’-tetraacetic acid (EGTA) (Fisher scientific) and was kept in a CO2 (5% v/v ...
-
bioRxiv - Biochemistry 2022Quote: ... Immunoprecipitated protein was enzymatically labeled utilizing the permissive mutant β-1,4-galactosyltransferase (Gal-T1 Y289L) which transfers azido-modified galactose (GalNAz) from UDP-GalNAz to O-GlcNAc residues on the target proteins (ThermoFisher Scientific C33368). The labelled lysate was then clicked on with biotin-alkyne using copper catalyzed azide-alkyne click chemistry reaction protocol according to manufacturer’s instruction (ThermoFisher Scientific C33372) ...
-
bioRxiv - Microbiology 2023Quote: ... cells were incubated with O-propargyl-puromycin (OPP) using Click-iT® Plus OPP Alexa Fluor® 488 Protein Synthesis Assay Kit (Invitrogen) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2023Quote: ... OPP (O-propargyl-puromycin) incorporation assays were performed using the Click-iT Plus OPP Protein Synthesis Assay kit (#C10456, Thermo Fisher Scientific), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... cells were incubated with O-propargyl-puromycin (OPP) using Click-iT® Plus OPP Alexa Fluor® 488 Protein Synthesis Assay Kit (Invitrogen) according to the manufacturer’s guidelines ...
-
bioRxiv - Plant Biology 2021Quote: ... Antibody-coated Protein A Dynabeads (Invitrogen) were incubated 12 hours at 4 °C with the samples ...
-
bioRxiv - Plant Biology 2023Quote: ... Antibody-coated Protein A Dynabeads (Invitrogen) were incubated 12 h at 4°C with the samples ...
-
bioRxiv - Cell Biology 2020Quote: ... Coverslips were washed 3 times in PBS and secondary antibodies (Oregon Green - Thermofisher O-6382, Texas Red – Thermofisher T-6390) diluted in blocking buffer at 1:500 and applied for 2h in the dark at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... fixed parasites were incubated with 5µg/mL Blood Group Antigen H (O) Type 1 monoclonal antibody (Invitrogen 13-9810-82), washed three times with 1x PBS and incubated with 1:100 α-mouse secondary antibody conjugated to Alexa 488 (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: Freshly prepared solubilized proteins were incubated o/n at 4°C with affinity-purified rabbit anti-P2X4 antibodies (Alomone) cross-linked to magnetic beads (Dynabeads, Invitrogen). The flow through was discarded and the beads washed 5 times with wash buffer (CL48 diluted ¼ in PBS and supplemented with complete protease inhibitor cocktail (Roche) ...
-
bioRxiv - Biochemistry 2023Quote: ... 3×104 cells/well/40 µL were incubated with 5 nM of mono- or bispecific antibody constructs in flow buffer (DPBS w/o Ca and Mg (PAN-Biotech) with 3% heat inactivated FBS (Gibco)) for 1 hour at 4°C in a V-Bottom 384 well plate (Greiner) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were blocked for 2hrs at RT in 5% milk powder and then incubated overnight (o/n) at 4°C with primary rabbit anti-GFP antibody (1:1,000; Molecular Probes). Membranes were washed 3x for 10min in 1X TBST ...
-
bioRxiv - Cell Biology 2021Quote: ... After two washing steps in phosphate-buffer saline w/o calcium and magnesium (PBS w/o Ca and Mg, Thermo Fisher Scientific) and optional erythrocyte lysis (Quiagen ...
-
bioRxiv - Cell Biology 2019Quote: ... a 10% FBS DMEM (w/o phenol red; Invitrogen) staining buffer was used ...
-
bioRxiv - Neuroscience 2020Quote: ... washed twice with HBSS w/o phenol red (Gibco) and then equilibrated for 10 min in HBSS w/o phenol red and live imaged at 555 nm with a Zeiss LSM 700 confocal microscope ...
-
bioRxiv - Genomics 2021Quote: ... containing B-27 w/o Vitamin A (Gibco, 12587010), GlutaMAX ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-O-GlcNAc (RL2) (mouse, Thermo Fisher Scientific Inc.), anti-GAPDH (mouse ...
-
bioRxiv - Immunology 2020Quote: ... and stained with 0.003% Safranine O (Acros Organics 146640250) for 4 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... media containing 2% B27 supplement (w/o insulin, Gibco), and additional recombinant factors including Activin A (100ng/ml ...