Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 7H Pyrrolo 2 3 c pyridin 7 one 1 6 dihydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Physiology 2019Quote: ... and HDMBOA (4,7-dimethoxy-2-{[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy}-3,4-dihydro-2H-1,4-benzoxazin-3-one)) (Block et al., 2019) (Yang et al., 2019) were quantified using HPLC (Thermofisher scientific) which was coupled with MS (UltiMate 3000 HPLC ...
-
bioRxiv - Cell Biology 2023Quote: ... For nuclear staining 0.5µg/µL of DAPI (4’, 6-diamidino-2-phenylindole, dihydro-chloride, Invitrogen. Cat. No.: D3571) was added along with secondary antibody ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Immunology 2019Quote: ... for 1h at 37°C or 2 μM CellEvant CASPASE-3/7 Green detection reagent (Thermo Fisher) for 30 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were incubated with 2.5 µM DCFH-DA (2’,7’-dichloro-dihydro-fluorescein-diacetate; excitation at 495 nm, emission at 520 nm; Life Technologies, Europe BV, Stockholm, Sweden) in Hank’s buffered saline solution without phenol red for 30 min at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Cell Biology 2022Quote: ... DCFH-DA (6-carboxy-2′,7′- dichlorodihydrofluorescein diacetate) was from Invitrogen. DMSO and Evans Blue Dye were purchased from Sigma Aldrich ...
-
bioRxiv - Physiology 2020Quote: ... and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... Then one drop of DAPI (4′, 6-diamidino-2-phenylindole, ThermoFisher Scientific) was added to the suspension and 25 nuclei were sorted by Aria II (BD ...
-
bioRxiv - Immunology 2020Quote: ... then labelled with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceinacetoxymethyl ester (Life Technologies, UK). Neutrophils were then added to wells under normoxia or hypoxia ...
-
bioRxiv - Genetics 2019Quote: ... Day 6–7: DMEM (Gibco) with 25 mM glucose containing 1:100 B27 (Gibco ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... potential was examined using 5,6-dichloro-2-[3-(5,6-dichloro-1,3-diethyl-1,3-dihydro-2H-benzimidazol-2-ylidene)-1propenyl]-1,3-diethyl-,iodide (JC-1 dye) (Life Technologies, USA) as a probe ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5-(and-6)-chloromethyl-2′,7′ dicholorodihydrofluorescein diacetate (CM-H2DCFDA; Molecular Probes C6827), was used to visualize ROS accumulation (excitation ...
-
bioRxiv - Immunology 2022Quote: ... or 2.5μM of 5-(and-6)-Carboxy-2’,7’-Dichlorofluorescein Diacetate (DCFDA) (Invitrogen) was then added and incubated with the cells 20 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 5- (and -6)-chloromethyl- 2′,7′-dichlorofluorescein diacetate (CM-H2DCFDA, ThermoFisher, C6827), or hydroxyphenyl fluorescein (HPF ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were counterstained using 4′,6-diamidin-2-phenylindol (DAPI, 1:1000, 7 min; D1306, Thermo Fisher Scientific). Washing steps were performed with PBS ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Cell Biology 2022Quote: ... dihydro-chloride (DAPI) (Invitrogen. Cat. Nº: D3571) at 0.5 µg/µl ...
-
bioRxiv - Microbiology 2022Quote: The PfHDAC1-2xFKBP-GFP knockin NF54 line parasitized RBCs (mock or 100 nM dihydro artemisinin treated from ∼21-24 HPI/3 hours) were crosslinked using 1% formaldehyde (Thermo Scientific, 28908) for 10 mins at RT ...
-
bioRxiv - Microbiology 2024Quote: ... Propidium iodide (PI) and the pH sensitive 2’,7’-Bis-(2-Carboxyethyl)-5-(and-6)-Carboxyfluorescein (BCECF) (Invitrogen) were added to these at a final concentration of 100µM and 10µM respectively ...
-
bioRxiv - Immunology 2020Quote: ... cells were treated with 2 mM caspase-3/7 detection reagent (Fisher Scientific) for 30 min ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific). Images were captured automatically every two hours for 48 hours using the IncuCyte™ S3 Live-Cell Analysis Instrument (Essen BioScience) ...
-
bioRxiv - Cell Biology 2023Quote: ... and treated with 2 µM Caspase-3/7 Green detection reagent (C10423, Invitrogen) along with the specified compounds ...
-
bioRxiv - Neuroscience 2024Quote: ... wells were treated with Caspase-3/7 (CellEvent™ Caspase-3/7 Green, Invitrogen) 1:1000 in treatment media ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: Bone marrow was collected from tibias and femurs of 4-6 mo female C57BL/6 mice and cultured for 7 days at 37°C and 5% CO2 in DMEM (Gibco,11995-073) supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5(6)-carboxy-2’,7’-dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA; CA-DCF-DA; (C400, ThermoFisher Scientific)) at a stock concentration of 20 mM in DMSO was diluted in DMEM without phenol red to a concentration of 40 μM ...
-
bioRxiv - Cell Biology 2020Quote: ... then loaded with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethylester (BCECF-AM, 1.6 μM, Life Technologies) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... QuantStudio 6/7 Pro systems (Applied Biosystems). The following primers were used ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Microbiology 2021Quote: ... or 10 μM 7-hydroxy-9H-(1,3-dichloro-9,9-dimethylacridin-2-one) succinimidyl ester (DDAO-SE) (Invitrogen) in HMI11 and incubated for 20 min at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... CellEvent caspase-3/7 green detection reagent (C10423; Invitrogen; 1:1000) was used to measure apoptosis ...
-
bioRxiv - Cell Biology 2019Quote: ... Caspase-3/7 activation in live cells was monitored using CellEvent Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific, C10423, 1:1000) in IncuCyte Live Cell Analysis System ...
-
bioRxiv - Biochemistry 2021Quote: ... The protein was run over either one (at 10°C) or two (at 10°C and 2°C) immobilized pepsin columns (Applied Biosystems; Poroszyme Immobilized Pepsin Cartridge ...
-
bioRxiv - Cell Biology 2021Quote: ... program #3 for 7 min (ThermoFisher). The membrane was saturated by incubation in PBS (without EDTA ...
-
bioRxiv - Plant Biology 2020Quote: ... on 4-16% (Figures 4A and 7) or 3-12% (Figures 4C and 6) NativePAGE gels (Life technologies). Cathode Running buffer (Life technologies ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Microbiology 2021Quote: ... or with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) for 30 min at room temperature (1:150 in AnnexinV binding buffer-Biolegend) ...
-
bioRxiv - Cell Biology 2019Quote: ... or caspases 3/7 (Caspase-3/7 Green ReadyProbes™ reagent with a DEVD sequence, Molecular Probes).
-
bioRxiv - Cell Biology 2019Quote: ... or caspases 3/7 (Caspase-3/7 Green ReadyProbes™ reagent with a DEVD sequence, Molecular Probes).