Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 7H 9 6 Methenofuro 2 3 f oxacycloundecin 2 7 3H dione 3a 4 5 9 10 12a hexahydro 11 methyl 3 methylene 3aR 9S 11E 12aS 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3-9) or 5 µl (IP: Figure 2A-2C and input: Figure 2-9) RNAse A/T1 (Thermo Scientific #EN0551) and incubation the beads at 37°C for 30 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen) at 2 mg/ml in PBS for 10 min or with Laurdan (see above ...
-
bioRxiv - Bioengineering 2019Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid;D3823, Thermo Fisher Scientific), was added to the culture medium for a duration of 60 min and pumped through the media systems at 80 µl/h via positive pressure provided by a syringe pump ...
-
bioRxiv - Zoology 2020Quote: ... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
bioRxiv - Developmental Biology 2021Quote: Embryos and larvae from 9 hpf to 4 wpf were incubated in 3 µM 5-Ethynyl-2′-deoxyuridine (EdU; ThermoFisher Scientific, cat#: C10639) in FSW for 15-30 min ...
-
bioRxiv - Biochemistry 2022Quote: ... 4,4-difluoro-5-(2-thienyl)-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (BODIPY-C12, Invitrogen D3835), was dissolved in 100% ethanol and conjugated to 10% bovine serum albumin ...
-
bioRxiv - Microbiology 2020Quote: ... Fungal hyphae were stained with 0.5 mM 4.4-difluoro-5-methyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (C1-BODIPY 500/510 C12, Thermo Fisher Scientific) or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16 ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 10% Fetal Bovine Serum (FBS-12A, Capricorn Scientific) and penicillin/streptomycin (100μg/mL, Gibco). Cell lines were subjected to regular Mycoplasma testing ...
-
bioRxiv - Genomics 2023Quote: ... supplemented with 10% Fetal Bovine Serum (FBS-12A, Capricorn Scientific) and penicillin/streptomycin (100μg/mL, Gibco). Cell lines were subjected to regular Mycoplasma testing ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... and HMI-11 (HMI-9 (Gibco), 10 % v/v FCS (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell proliferation was assessed at different time points (3, 5, 7 and 9 days) using AlamarBlue Cell Viability Reagent (Invitrogen) per manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl) containing N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM; Invitrogen) at a final concentration of 10 μM and incubated for 30 min in the dark on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... or BODIPY™ 558/568 C12 (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Pathology 2020Quote: ... 6-dihydroxy-2,4,5,7-tetraio-dospiro (isobenzofuran-1(3H),9[9H] xanthan)-3:1 dipotassium salt (50 mg/kg in 0.9% saline, Fisher Scientific) was injected retro-orbitally before catalyzing vessel injury with a 540 nm laser ...
-
bioRxiv - Neuroscience 2019Quote: ... cortical cultures were loaded with fluo-4 AM (3 μM) or fura-2 AM (3 μM) plus 0.1% Pluronic F-127 (ThermoFisher) in a HEPES-buffered saline solution (HCSS ...
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Genomics 2020Quote: ... Two TaqMan probes targeting the MLLT3 exon 3-4 and exon 9-10 splice junctions (ThermoFisher, Hs00971092_m1 and Hs00971099_m1) were used with cDNA diluted 1:5 in dH2O to perform qPCR for six replicates per sample on an Applied Biosystems Quant Studio 6 Flex ...
-
bioRxiv - Cell Biology 2022Quote: ... 9 μl of carboxyl latex bead (4% w/v, 2 μm; Invitrogen, C37278), and 2 μl of Concanavalin A (1 mg/ml ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Genomics 2023Quote: ... and 100 μg/ml cycloheximide using Beckman Coulter UC tubes 9/16 x 3-1/2 (Fisher Scientific, NC9194790), and equilibrating overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... MCF-12A and HL7702 cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Gibco). All media were supplemented with 10% fetal bovine serum (HyClone) ...
-
bioRxiv - Cancer Biology 2021Quote: ... AEC (3-amino-9-ethyl carbazole) chromogen (Thermo Fisher Scientific) was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Treatments were incubated 2 hours before addition of the MTS (3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) reagent (Thermo-Fisher Scientific, Waltham, MA) and incubation was continued another 1.5 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... 2- & 3-methyl pentane and n-hexane (Thermo Scientific, Waltham, MA, USA). Reported compounds detected by the GC-MS were confirmed by matching retention times and mass–charge (m/z ...
-
bioRxiv - Developmental Biology 2022Quote: ... On day 3-9 cells were fed daily with Essential 6 medium (E6, #A1516401, Thermo Fisher Scientific) in the presence of 100 nM LDN193189 (#72142 ...
-
bioRxiv - Molecular Biology 2019Quote: ... either 50 µl (Figure 2A-2C, 7 and 8) or 25 µl (Figure 2D, 2E, 3-7 and 9) magnetic beads (Dynabeads protein G, Life Technologies #10004D) was used ...
-
bioRxiv - Molecular Biology 2020Quote: ... Per2Luc mice and littermate wild-type control mice were euthanized by isoflurane 2-3 hours before lights off (ZT 9–ZT10) and tissues were immediately removed into ice-cold HBSS (Gibco). Coronal brain slices containing SCN (400-µm thickness ...
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 and 9 μg respectively using Lipofectamine 2000 (Thermo Fisher, 11668027). Infectious supernatant was collected at 48 and 72 hours after transfection and filtered to remove cell debris ...
-
bioRxiv - Cell Biology 2023Quote: ... 9 was performed using a QuantStudio™ 3 (Thermo Fisher Scientific) with an Applied Biosystems PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were marked with 2,3×10−3 μg/μL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 minutes at room temperature in the dark ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 9) or citrate buffer (10 mM, pH 6, ThermoFisher Scientific) as required for each primary antibody ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...