Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 7 BENZYLOXY 3 METHYL 5 NITROINDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl) containing N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM; Invitrogen) at a final concentration of 10 μM and incubated for 30 min in the dark on ice ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The activity of the major drug metabolizing enzyme CYP3A4 supported by WT or POR-284T was tested using the fluorogenic substrates [BOMCC (7-Benzyloxy-4-trifluoromethylcoumarin) (Invitrogen Corp, Carlsbad, CA) as described earlier (Flück et al. ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).
-
bioRxiv - Microbiology 2020Quote: ... 5 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific) were applied for monitoring effector caspase activation and 2.5 µM AlexaFluor647 hydrazide for detecting cell lysis.
-
bioRxiv - Cell Biology 2022Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen) at 2 mg/ml in PBS for 10 min or with Laurdan (see above ...
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Neuroscience 2024Quote: ... wells were treated with Caspase-3/7 (CellEvent™ Caspase-3/7 Green, Invitrogen) 1:1000 in treatment media ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 mM methyl-β-cyclodextrin (Acros Organics, NJ) (mβCD ...
-
bioRxiv - Molecular Biology 2019Quote: ... miR-125b+A or control RNA 3’O-methyl-modified mimic using 5 μl Lipofectamine 2000 (Life Technologies) in a 500 μl reaction mixture according to the manufacturer’s instructions ...
-
bioRxiv - Zoology 2020Quote: ... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Bioengineering 2019Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid;D3823, Thermo Fisher Scientific), was added to the culture medium for a duration of 60 min and pumped through the media systems at 80 µl/h via positive pressure provided by a syringe pump ...
-
bioRxiv - Microbiology 2020Quote: ... and 1:1 3-methyl-1-butanol (Thermo Fisher Scientific) in mineral oil were used as cues ...
-
bioRxiv - Cell Biology 2021Quote: ... program #3 for 7 min (ThermoFisher). The membrane was saturated by incubation in PBS (without EDTA ...
-
bioRxiv - Cell Biology 2019Quote: ... or caspases 3/7 (Caspase-3/7 Green ReadyProbes™ reagent with a DEVD sequence, Molecular Probes).
-
bioRxiv - Cell Biology 2019Quote: ... or caspases 3/7 (Caspase-3/7 Green ReadyProbes™ reagent with a DEVD sequence, Molecular Probes).
-
bioRxiv - Immunology 2023Quote: ... The caspase-3/7 activity assay contained CellEvent Caspase- 3/7 Green Detection Reagent (Thermo Fisher, C10723) at a final ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... CellEvent Caspase-3/7 Detection Reagent (Invitrogen) and Hoescht were added to the media at concentrations listed in S4 Table and incubated for 30min at 37°C in 5% CO2 ...
-
bioRxiv - Cell Biology 2020Quote: ... CellEvent Caspase-3/7 (Life Technologies C10723), Fis1 polyclonal antibody (Proteintech 109561-AP) ...
-
bioRxiv - Cell Biology 2023Quote: ... Caspase 3/7 (Thermo Fisher Scientific, #C10423) activation and propidium iodide (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... and caspase 3/7 (Thermo Fisher Scientific) were prepared following the manufacturer instructions ...
-
bioRxiv - Immunology 2020Quote: ... Detection of active caspase 3/7 was accomplished using CellEvent™ Caspase-3/7 Red Detection Reagent (ThermoFisher Scientific). Sorted CD4SP Rag1GFP+ thymocytes were stained with CD5-PerCP-Cy5.5 (53-7.3 ...
-
bioRxiv - Microbiology 2020Quote: ... PobA activity was inhibited with methyl 4-hydroxy-3-iodobenzoate (Fisher Scientific) at a saturating concentration (0.48 mM) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2- & 3-methyl pentane and n-hexane (Thermo Scientific, Waltham, MA, USA). Reported compounds detected by the GC-MS were confirmed by matching retention times and mass–charge (m/z ...
-
bioRxiv - Microbiology 2023Quote: ... The infection was incubated for 2-3 hours at 37°C and then the viral inoculum was removed and replaced with a pH 7.2 methyl cellulose overlay medium (1% methyl cellulose [Sigma-Aldrich, MA]/5% FBS [Gibco, MA]/1X penicillin-streptomycin [Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... The infection was incubated for 2-3 hours at 37°C and then the viral inoculum was removed and replaced with a pH 7.2 methyl cellulose overlay medium (1% methyl cellulose [Sigma-Aldrich, MA]/5% FBS [Gibco, MA]/1X penicillin-streptomycin [Gibco, MA]/44 mM sodium bicarbonate [Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... Fungal hyphae were stained with 0.5 mM 4.4-difluoro-5-methyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (C1-BODIPY 500/510 C12, Thermo Fisher Scientific) or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16 ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase 3/7 activity was assessed using the CellEvent Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Scientific, #C10427) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... and CellEvent caspase-3/7 reagent (ThermoFisher Scientific) were used according to manufacturer protocol ...
-
bioRxiv - Immunology 2022Quote: ... and Cell Event Caspase-3/7 Green (Invitrogen) were loaded at the final concentration of 5 µM and 7 µM respectively along with the cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... Caspase-3 and −7 Cell Imaging Kit (Invitrogen), and Propidium iodide (PI ...
-
bioRxiv - Systems Biology 2024Quote: ... CellEventTM Caspase 3/7 detection reagent (Invitrogen C10423), and SYTOXTM AAdvanced Dead Cell Stain (Invitrogen S10349) ...
-
bioRxiv - Immunology 2019Quote: ... IL-7 (5 ng ml−1; ThermoFisher), and IL-15 (5 ng ml−1 ...
-
bioRxiv - Bioengineering 2019Quote: ... IL-7 at 5 ng/mL (ThermoFisher), and IL-15 at 5 ng/mL (ThermoFischer) ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Cancer Biology 2020Quote: Apoptosis induction was determined by activation of Caspase 3 and 7 using the CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen).H460 cells were plated at 5 × 103 cells/well in black 96 well plates with clear bottoms (Costar ...
-
bioRxiv - Neuroscience 2021Quote: ... The culture medium was changed every 2 to 3 days and the cells were split every 5 to 7 days using 0.25% Trypsin-EDTA (Gibco), up to 20 times ...
-
bioRxiv - Cell Biology 2023Quote: CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: CellEvent® Caspase 3/7 Green (Thermo Fisher, UK) was used to evaluate cell apoptosis ...
-
bioRxiv - Cancer Biology 2023Quote: ... the CellEvent Caspase-3/7 Green Detection kit (Invitrogen) was used with propidium iodide as a viability marker ...
-
bioRxiv - Microbiology 2023Quote: ... Tris(hydroxymethyl)methyl-3-amino propane sulfonic acid (TAPS) was purchased from Acros Organics. Mal-PEG ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2019Quote: ... Caspase-3/7 activation in live cells was monitored using CellEvent Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific, C10423, 1:1000) in IncuCyte Live Cell Analysis System ...
-
bioRxiv - Cancer Biology 2020Quote: Apoptosis was measured by caspase-3/7 staining using CellEvent® Caspase-3/7 Green ReadyProbes® Reagent (ThermoFisher Scientific Inc., cat# R37111). CHLA20 and NGP cells were grown until confluence on 6-well plates with six days of treatment with DMSO or GSK591 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 48hrs after transfection the cells were fixed and stained for activated Caspase-3/7 using Apoptosis CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) according to manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 L-malic acid and 20 μM tetramethylrhodamine methyl ester (TMRM, Thermo Fisher) for 10 minutes ...
-
bioRxiv - Immunology 2022Quote: ... 5-7 × 106 cells were resuspended in 3 mL of FACS buffer (4% FBS in phosphate buffered saline (PBS, Gibco)) and sorted at the University of Massachusetts Amherst Flow Cytometry Core Facility using a BD FACSAria Fusion (Becton Dickinson) ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell proliferation was assessed at different time points (3, 5, 7 and 9 days) using AlamarBlue Cell Viability Reagent (Invitrogen) per manufacturer’s instructions ...