Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... AEC (3-amino-9-ethyl carbazole) chromogen (Thermo Fisher Scientific) was used ...
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Cell Biology 2021Quote: ... PDMPO [2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-amino-carbamoyl)methoxy)-phenyl)oxazole] (ThermoFisher Scientific, USA) was added to a final concentration of 330 µM ...
-
bioRxiv - Microbiology 2019Quote: ... and HMI-11 (HMI-9 (Gibco), 10 % v/v FCS (Gibco ...
-
bioRxiv - Genetics 2022Quote: Immunoprecipitations were performed using 1 μg of Anti-Trimethyl-Histone-3-Lys-4 (-Thermo Fisher Scientific; catalog# PA5-17420) overnight at 4 ◦ C ...
-
bioRxiv - Neuroscience 2020Quote: ... All 27 samples from 3 groups and 6 GIS were divided and labeled using two sets of 5 mg 11 plex TMT reagents (Thermo Scientific A34808 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... pseudonana expressing VHAB-eGFP were incubated with the acidotropic pH stain 2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-aminocarbamoyl)methoxy)phenyl)oxazole (PDMPO) (LysoSensor YellowBlue DND-160; Life Technologies) at a final concentration of 0.125 μM without washing in F/2 ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA#4: 5’-AUAGCGUUUCUUCUAACUGGGCAGC-3’ (Invitrogen). siRNAs #2 and #4 significantly decreased the mRNA levels to the greatest extent and both had the same mitotic phenotypes ...
-
bioRxiv - Neuroscience 2019Quote: ... post-axotomy cultures were loaded with lipophilic dye N-(3-trimethylammoniumpropyl) -4-(6-(4-(diethylamino) phenyl) hexatrienyl)pyridinium dibromide (FM 5–95; Invitrogen) using KCl mediated depolarization as described previously (Taylor et al ...
-
bioRxiv - Plant Biology 2024Quote: ... or X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside, W5376C; Thermo Fisher Scientific, Guilford, CT). GUS and/or LacZ-stained tissues were cleared for 30 s with 12 % sodium hypochlorite solution before microscopy observations.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA primer sets A (KS40 5’-ACCGACCACAGAAACTGCGACTAG -3’ and KS41 5’-AACCTAGTCGCAGTTTCTGTGGTC-3’) and B (KS42 5’-CCGTCCCACTGGCACCGCTTTATG-3’ and KS43 5’-AAACATAAAGCGGTGCCAGTGGGA-3’) were phosphorylated with T4 polynucleotide kinase (ThermoFisher) at 37°C for 30 min and annealed by cooling down from 85°C to 25°C at 0.1°C/sec ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Genomics 2023Quote: ... then incubated for 4-6h with 100 ul Dynabeads Protein A (Invitrogen, 10002D) or Protein G (Invitrogen ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Microbiology 2020Quote: ... the aminoethyl carbazole (AEC) substrate kit (Thermo Fisher) was used to detect IE1 positive nuclei ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3-9) or 5 µl (IP: Figure 2A-2C and input: Figure 2-9) RNAse A/T1 (Thermo Scientific #EN0551) and incubation the beads at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Microbiology 2023Quote: ... was used for induction of gene expression and X-gal (X-Gal 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside; Thermofisher) TSA plates were used for bacterial assessment ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Developmental Biology 2021Quote: Embryos and larvae from 9 hpf to 4 wpf were incubated in 3 µM 5-Ethynyl-2′-deoxyuridine (EdU; ThermoFisher Scientific, cat#: C10639) in FSW for 15-30 min ...
-
bioRxiv - Microbiology 2023Quote: ... Briefly, inner wells (rows B–G, columns 3–11) of a 96-well flat-bottomed microtiter plate (ThermoFisher Scientific) were filled with 75 µl 7H9 media ...
-
bioRxiv - Developmental Biology 2023Quote: α6-FITC (1:200, Invitrogen, 11-0495-82),
-
bioRxiv - Developmental Biology 2022Quote: ... On day 3-9 cells were fed daily with Essential 6 medium (E6, #A1516401, Thermo Fisher Scientific) in the presence of 100 nM LDN193189 (#72142 ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Molecular Biology 2022Quote: ... siM1-4: 5’ -ACTGGTAGCTTATTAAAGATT- 3’) and the HOXA1 siRNA (5’ - AGAACTTCAGTGCGCCTTATT- 3’) were purchased from Invitrogen™ (Silencer® Select siRNA ...
-
bioRxiv - Genomics 2024Quote: ... for 6h using lipofectamine 3000 (Invitrogen). Knockdown was confirmed by RT-qPCR at 24-72h post-transfection.
-
bioRxiv - Plant Biology 2024Quote: ... for 6h at 4°C and an additional 2h at 4°C with 20μl Dynabeads Protein G (#10003D, ThermoFisher) blocked with 0.1% BSA ...
-
bioRxiv - Plant Biology 2022Quote: ... N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM 4-64; 50 μM) (Invitrogen) or propidium iodide (PI ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Cell Biology 2020Quote: ... 6 or 9 µl of 20 µM siRNA and 4 µl of Lipofectamine RNAi MAX (13778150, Invitrogen) were suspended in 100 µl of water (W4502 ...
-
bioRxiv - Cell Biology 2022Quote: ... 6 or 9 μl of 20 μM siRNA and 4 μl of lipofectamine RNAi MAX (Invitrogen, 13778150) were suspended in 100 μl of water (Sigma ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 x 5 min) on a rocking platform and stained with 4′,6-diamidino-2- phenylindole dihydrochloride (DAPI) (Life Technologies) staining (2 μM ...
-
bioRxiv - Plant Biology 2019Quote: To assess GUS expression driven by the maize ubiquitin promoter in transgenic barley transformed with the pBRACT214m-GUS construct we collected different tissues and stained these with 1mg/ml of X-gluc (5-bromo-4-chloro-3-indolyl-B-D-glucuronic acid, Thermo Scientific, USA) in X-gluc buffer (100mM sodium phosphate buffer pH 7.0 ...
-
bioRxiv - Microbiology 2021Quote: ... siDDX42-4: 5’-AUCUCGAAUACCCUUUACG-3’ (ID:136410, Ambion®).
-
bioRxiv - Bioengineering 2022Quote: ... 5 kDa methoxy-poly(ethylene glycol)-succinimidyl valerate (mPEG-SVA) (ThermoFisher Scientific, Waltham, MA), 0.1 M 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Bioengineering 2020Quote: ... 3) latrunculin-b (Lat-B; 2 μM; Fisher Scientific), 4 ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2024Quote: ... and 3% amphotericin B (Gibco)) ...
-
bioRxiv - Microbiology 2019Quote: ... brucei 2T1 bloodstream forms 40 and were cultured in HMI-11 [HMI-9 (GIBCO) containing 10% v/v foetal bovine serum (GIBCO) ...
-
bioRxiv - Neuroscience 2022Quote: Neurons were transfected at 9-11 days in vitro (DIV) using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol and used for experiments on DIV 12-15.
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Cell Biology 2019Quote: ... FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) was purchased from Invitrogen. Rapamycin was purchased from LC Laboratories ...