Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 methyl 5 6 7 8 tetrahydro 1 3 dioxolo 4 5 g isoquinolin 6 iumchloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Immunology 2021Quote: ... 5/6 weeks and 6/7 weeks post-infection by flow cytometry using counting beads (CountBright, ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... 5-(and-6)-carboxyfluorescein (FAM) and 5-(and-6)-carboxytetramethylrhodamine (TAMRA) were obtained from Invitrogen™ ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-cytokeratin 5/6 (Invitrogen, MA191106) (1:100 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5-(and-6)-chloromethyl-2′,7′ dicholorodihydrofluorescein diacetate (CM-H2DCFDA; Molecular Probes C6827), was used to visualize ROS accumulation (excitation ...
-
bioRxiv - Immunology 2022Quote: ... or 2.5μM of 5-(and-6)-Carboxy-2’,7’-Dichlorofluorescein Diacetate (DCFDA) (Invitrogen) was then added and incubated with the cells 20 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 5- (and -6)-chloromethyl- 2′,7′-dichlorofluorescein diacetate (CM-H2DCFDA, ThermoFisher, C6827), or hydroxyphenyl fluorescein (HPF ...
-
bioRxiv - Immunology 2024Quote: ... 5 µg of anti-CD8α APC-efluo780 (clone 53-6-7, eBioscience/Thermofisher) was injected intravenously (i.v. ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Genetics 2019Quote: ... Day 6–7: DMEM (Gibco) with 25 mM glucose containing 1:100 B27 (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... MAN0017058 by Invitrogen (pages 5 and 6). A non-targeting sgRNA that does not recognize any sequence in the human genome was used as a negative control (Invitrogen Cat# ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: Bone marrow was collected from tibias and femurs of 4-6 mo female C57BL/6 mice and cultured for 7 days at 37°C and 5% CO2 in DMEM (Gibco,11995-073) supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole at 5 µg/mL (DAPI; ThermoFisher) in TBS 1% BSA ...
-
bioRxiv - Developmental Biology 2020Quote: ... containing 4’,6-diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... Reverse 5′-CGA AGG TGT GAC TTC CAT G-3′) on a QuantStudio 6 Flex thermocycler (Applied Biosystems). Standard curve was established in parallel using purified SARS-CoV-2 viral RNA.
-
bioRxiv - Neuroscience 2019Quote: ... post-axotomy cultures were loaded with lipophilic dye N-(3-trimethylammoniumpropyl) -4-(6-(4-(diethylamino) phenyl) hexatrienyl)pyridinium dibromide (FM 5–95; Invitrogen) using KCl mediated depolarization as described previously (Taylor et al ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5(6)-carboxy-2’,7’-dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA; CA-DCF-DA; (C400, ThermoFisher Scientific)) at a stock concentration of 20 mM in DMSO was diluted in DMEM without phenol red to a concentration of 40 μM ...
-
bioRxiv - Cancer Biology 2019Quote: ... All TaqMan probes were 5′-6-carboxyfluorescein (FAM) and 3′-6-carboxy-N,N,N′,N′-tetramethylrhodamine (TAMRA) labeled (Applied Biosystems, US) except TATA-binding protein (TBP ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 5-6 pieces per well were cultured in a 6-well culture plate (Fisher Scientific). For up to two weeks tissue pieces were cultured in Advanced Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Immunology 2020Quote: ... then labelled with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceinacetoxymethyl ester (Life Technologies, UK). Neutrophils were then added to wells under normoxia or hypoxia ...
-
bioRxiv - Molecular Biology 2022Quote: ... was co-transfected with either pre-gRNA or gRNA expression plasmids (1 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cells were first transfected with the pcDNA3_CasRx-GFP plasmid (2.5 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Physiology 2020Quote: ... and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... was mixed with 5/6 TAMRA-OSu (Thermofisher #C1171) in DMSO ...
-
bioRxiv - Immunology 2020Quote: ... 5% CO2 for 6 days in RPMI (Life Technologies) supplemented with [5%] AB serum ...
-
bioRxiv - Biochemistry 2024Quote: ... NHS-5/6-carboxyfluorescein (NHS-fluorescein, Thermo Fisher 46410), NHS-Oregon Green (Thermo Fisher O6147) ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 5 µg / µl 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) and slides were mounted with FluoromountG (SouthernBiotech).
-
bioRxiv - Immunology 2021Quote: ... mouse interleukin 6 (IL-6; ThermoFisher; 1:500). Sections were then stained for DAPI (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were washed then incubated in 8 μM of the ROS sensitive probe 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate acetyl ester (CM-H2DCFDA) (Molecular Probes, Eugene Oregon), for 45 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... QuantStudio 6/7 Pro systems (Applied Biosystems). The following primers were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... ANBL-6 cells were also supplemented with 5 ng/ml IL-6 (Thermo Fisher Scientific, Cat# 206IL010).
-
bioRxiv - Immunology 2022Quote: ... 2DG (Thermo Fisher, 6 g/L) was dissolved in drinking water and was provided to mice ad libitum ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 x 5 min) on a rocking platform and stained with 4′,6-diamidino-2- phenylindole dihydrochloride (DAPI) (Life Technologies) staining (2 μM ...
-
bioRxiv - Cell Biology 2024Quote: Vacuolar pH alterations were detected using the 5-(and-6)-carboxy-2′,7′-dichlorofluorescein diacetate (CDCFDA, Invitrogen) probe ...
-
bioRxiv - Bioengineering 2020Quote: ... 4’-6-diamidino-1-phenylindole (DAPI, Life Technologies) was applied at 1 μg/mL for 90 minutes to stain the nuclei and the samples were washed and mounted with AquaPoly/Mount (Polysciences) ...
-
bioRxiv - Plant Biology 2020Quote: ... on 4-16% (Figures 4A and 7) or 3-12% (Figures 4C and 6) NativePAGE gels (Life technologies). Cathode Running buffer (Life technologies ...
-
bioRxiv - Microbiology 2021Quote: ... and 4 mg/l 5-(and-6)-carboxyfluorescein and succinimidyl ester (FITC; Thermo Fisher Scientific), respectively ...
-
Activation of innate immune cGAS-STING pathway contributes to Alzheimer’s pathogenesis in 5×FAD micebioRxiv - Neuroscience 2022Quote: ... Slides were counterstained with 5 μg/mL 4’,6-diamidino-2-phenylindole (DAPI; ThermoFisher Scientific) for 10 min at room temperature and washed with 1 × PBST (0.2% Triton-X 100 ...
-
bioRxiv - Cell Biology 2019Quote: ... TaqMan primers 5′ end labeled with 6-carboxyfluorescein (FAM; ThermoFisher), and cDNA diluted per manufacturer’s instructions ...