Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 fluoro 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... 5-fluoro-deoxy-uridine (FDU) and nerve growth factor (NGF) (Invitrogen). Half of the media volume was exchanged every 5 days until cells were collected for analysis.
-
bioRxiv - Neuroscience 2021Quote: ... either filled with 5 µl of 10% Fluoro-Ruby (Invitrogen, Carlsbad, CA, USA) or 5 µl of 2% Fast-Blue (Polysciences ...
-
bioRxiv - Cell Biology 2023Quote: ... then counterstained with Fluoro-gel II containing DAPI (Fluoro-Gel, Fisher Scientific Intl INC, PA). Asc-citrine photographs were taken using ZEISS microscopy (Carl Zeiss Industrial Metrology ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were counterstained with Fluoro-gel II containing DAPI (Fluoro-Gel, Fisher Scientific Intl INC, PA). Immunostaining images were taken using a Leica inverted microscope with a TCS SPEII confocal module and processed using LAS X software (Leica Microsystems Inc ...
-
bioRxiv - Biophysics 2023Quote: ... λex = 561 nm (Fluoro-Max; Fisher Scientific), 40 nm diameter dark red bead ...
-
bioRxiv - Microbiology 2020Quote: ... 5-(and-6)-carboxyfluorescein (FAM) and 5-(and-6)-carboxytetramethylrhodamine (TAMRA) were obtained from Invitrogen™ ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-cytokeratin 5/6 (Invitrogen, MA191106) (1:100 ...
-
A Polybasic Domain in aPKC Mediates Par6-Dependent Control of Membrane Targeting and Kinase ActivitybioRxiv - Cell Biology 2020Quote: ... cells were imaged in Fluoro-Brite medium (Life Technologies) using a Nikon A1R confocal laser scanning microscope though a 100x ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... MAN0017058 by Invitrogen (pages 5 and 6). A non-targeting sgRNA that does not recognize any sequence in the human genome was used as a negative control (Invitrogen Cat# ...
-
bioRxiv - Biochemistry 2023Quote: ... NaHCO3 and 150 μL acetone containing 4 mg/mL 1-fluoro-2-4-dinitrophenyl-5-L-alanine amide (L-FDAA, Thermo Scientific) was added ...
-
bioRxiv - Neuroscience 2021Quote: ... or Fluoro-Ruby (tetramethylrhodamine) conjugated to dextran amine (FR; Invitrogen) (Table 1) ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Biochemistry 2023Quote: Kinetic measurements of TrpBwt and its mutants were performed by monitoring 5-fluoro-L-Trp formation in a plate reader (Thermo Scientific Varioskan Lux) over 20 min at 290 nm using ΔE290 = 1.89 mM−1·cm−1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... was co-transfected with either pre-gRNA or gRNA expression plasmids (1 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cells were first transfected with the pcDNA3_CasRx-GFP plasmid (2.5 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Biochemistry 2020Quote: ... was mixed with 5/6 TAMRA-OSu (Thermofisher #C1171) in DMSO ...
-
bioRxiv - Immunology 2020Quote: ... 5% CO2 for 6 days in RPMI (Life Technologies) supplemented with [5%] AB serum ...
-
bioRxiv - Biochemistry 2024Quote: ... NHS-5/6-carboxyfluorescein (NHS-fluorescein, Thermo Fisher 46410), NHS-Oregon Green (Thermo Fisher O6147) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were allowed to grow for 96 h in drug containing medium (methyl methanesulfonate, Acros Organics 156890250, mitomycin C, Sigma M4287, 4-nitroquinoline 1-oxide, Sigma N8141, hydroxyurea, Acros Organics 151680250 ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 5-6 pieces per well were cultured in a 6-well culture plate (Fisher Scientific). For up to two weeks tissue pieces were cultured in Advanced Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Biophysics 2020Quote: ... green nanospheres (200 nm, 1% solids, Fluoro-Max, Thermo Scientific, CA, US) were premixed in the gelatin (1:20 ...
-
bioRxiv - Neuroscience 2022Quote: ... and Alexa Fluoro-488 goat anti-rabbit IgG (H+L) (Invitrogen, A11034) in wash solution for 2 hours at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... donkey Alexa Fluoro 647-conjugated anti-goat IgG (#A11001; Thermo Fisher Scientific), and goat Alexa Fluoro488-conjugated anti-rabbit IgG (#A11001 ...
-
bioRxiv - Cell Biology 2019Quote: ... TaqMan primers 5′ end labeled with 6-carboxyfluorescein (FAM; ThermoFisher), and cDNA diluted per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 - diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Immunology 2021Quote: ... 5/6 weeks and 6/7 weeks post-infection by flow cytometry using counting beads (CountBright, ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: ... ANBL-6 cells were also supplemented with 5 ng/ml IL-6 (Thermo Fisher Scientific, Cat# 206IL010).
-
bioRxiv - Molecular Biology 2023Quote: ... Biotin was immunostained using Alexa Fluoro 647-conjugated streptavidin (#S21374; Thermo Fisher Scientific).
-
bioRxiv - Bioengineering 2021Quote: ... The 5(6)-Carboxyfluorescein N-hydroxysuccinimide was purchased from Thermo Fisher Scientific (ON ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5 and 6 dpf with TRIzol reagent (Thermo Fisher Scientific, 15596018) and incubated at 37° C for 30 minutes with RQ1 RNase-Free DNase (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Cell Biology 2023Quote: Tubulin was labelled with (5(6)-TAMRA Succinimidyl Ester (Invitrogen, C1171) for fluorescence microscopy assays according to published methods (Consolati et al ...
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Cell Biology 2022Quote: ... Tissues were washed with PBS and incubated in Alexa Fluoro 488 and 647 (Invitrogen) concurrently in blocking solution for two hours at room temperature in a darkened chamber ...
-
bioRxiv - Neuroscience 2021Quote: ... unilateral injections of 50-80nl of the retrograde neuronal tracer Fluoro-Gold (Molecular Probes, Eugene ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The gels were mounted on fluoro-dishes using ProLong Gold Antifade Mountant (ThermoFisher Scientific). Samples were imaged using a Nikon A1+ confocal microscope equipped with DU4 detector ...
-
bioRxiv - Pathology 2020Quote: ... CHO cells were transfected with 5 ug of human cadherin-6 in pIRES-puro or mouse cadherin-6 in pCDNA3.1 via Lipofectamine 2000 (Invitrogen). After 48hrs ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cancer Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole at 5 µg/mL (DAPI; ThermoFisher) in TBS 1% BSA ...
-
bioRxiv - Developmental Biology 2020Quote: ... containing 4’,6-diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Cell Biology 2020Quote: ... Cells were passaged every 5 or 6 days using Versene (Gibco, A4239101). Clinical hESCs were tested weekly for mycoplasma contamination using a Myco-detection Kit (InvivoGen ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 Bcl6 and 6 Smyd2 KO livers using TRIzol reagent (Invitrogen #15596026) followed by purification using the RNeasy Mini kit (Qiagen #74014) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... С6 and CHO/5-HT2C were maintained in the F12 medium (Invitrogen). In all cases ...
-
bioRxiv - Bioengineering 2024Quote: ... Coupling 5-(and 6)-Carboxytetramethylrhodamine (TAMRA) mixed isomers (Thermo Scientific, Waltham, MA) and Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-PEG2-OH ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then counter-stained with fluoro-Nissl solution (Thermo Fisher Scientific Cat# N-21479). Sections were finally mounted on gelatine-coated glass slides ...