Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 chloro N 3 methoxypropyl pyridazin 3 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The carboxyl groups on the bead surfaces were functionalized with amine-reactive groups via N- ethyl-N’-(3-(dimethylamino)propyl)carbodiimide (EDC) and sulfo-N-hydroxysuccinimide (sulfo-NHS, Thermo Fisher) crosslinking for 20 minutes at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135 ...
-
bioRxiv - Cancer Biology 2019Quote: ... All TaqMan probes were 5′-6-carboxyfluorescein (FAM) and 3′-6-carboxy-N,N,N′,N′-tetramethylrhodamine (TAMRA) labeled (Applied Biosystems, US) except TATA-binding protein (TBP ...
-
bioRxiv - Cancer Biology 2020Quote: ... n = 3) or oligopyridylamides (5 µM ADH-1 or ADH-6, n = 3) using a combination of both TriZol (Thermo Fisher Scientific) and RNAeasy Mini Kit (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... dextran amine-tetramethylrhodamine (3 kDa; 12% in saline; Molecular Probes) was pressure injected unilaterally into the AON tract projecting to nIII ...
-
bioRxiv - Neuroscience 2022Quote: ... total RNA was extracted from freshly-dissected n=3 young (3-month-old) or n=3 aged (18-month-old) zebrafish brain in TRIzol (Invitrogen, 15596). Three independent experimental replicates were used for bulk RNA sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... Injections were also performed using dextran amine-tetramethylrhodamine (3 kDa; Molecular Probes). Alternatively ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Physiology 2020Quote: ... 0.05% 3-(N,N-dimethylmyristylammonio) propanesulfaonate Zwittergent detergent (Acros Organics) in 1% methanol ...
-
bioRxiv - Neuroscience 2021Quote: ... biotinylated dextran amine tracer (BDA; 3 kD version; Life Technologies Ltd, Paisley, UK), and (iv ...
-
bioRxiv - Biochemistry 2023Quote: ... batches of 3-6 SC-islets were embedded in extracellular matrix (Geltrex, Gibco, cat. n A1569601) and cultured for 7 days under perfusion ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA from control (n=3) and model (n=3) Huh7 cells were isolated by TRIZOL reagent (Thermo Scientific), and the RNA concentration ...
-
bioRxiv - Developmental Biology 2020Quote: RNA from Rbx2 fl/fl (n=3) and Rbx2cKO-Nes (n=3) P1 telencephalons was extracted using TRIzol (Invitrogen). Strand-specific and barcode-indexed RNA-seq libraries were generated from 1 μg total RNA each after poly-A enrichment using the Kapa Stranded mRNA-seq kit (KapaBiosystems ...
-
bioRxiv - Bioengineering 2020Quote: ... N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide HCl (50-848-678, Fisher Scientific), butyric acid (B103500-100ML ...
-
bioRxiv - Physiology 2020Quote: ... 0.05% 3-(N,N-Dimethylmyristylammonio) propanesulfonate zwittergent detergent (Acros Organics, 427740050)) containing protease inhibitor (Mammalian ProteaseArrest-APExBIO K1008) ...
-
bioRxiv - Plant Biology 2022Quote: ... N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM 4-64; 50 μM) (Invitrogen) or propidium iodide (PI ...
-
bioRxiv - Neuroscience 2019Quote: Proliferating hNPCs (n=3) or differentiating immature neurons (n=3) CTX0E16s were pelleted and lysed in TRI Reagent (Ambion, AM9738). Total RNA was then extracted per the manufacturer’s instructions ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Neuroscience 2019Quote: ... sections from post mortem controls (n=3) and 22qDS patients (n=3) were sectioned and mounted on positively charged slides (ThermoFisher Scientific). Sections were deparaffinized by washing in xylene followed by washing in 100% ...
-
bioRxiv - Immunology 2023Quote: ... viable CD45-CD34+Sca-I- cells were sorted from epidermal single cell suspensions of 1-month-old EGFRΔEgr2 (n=3) and littermate controls (n=3) into Trizol LS Reagent (Thermo Fisher Scientific) using a FACS Aria III ...
-
bioRxiv - Molecular Biology 2023Quote: ... HuH6 hCLDN1 [13] and Lunet N#3 and Lunet N#3 hCD81 [18] were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Thermo Fischer Scientific) supplemented with 1 % MEM non-essential amino acids (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135; 10 kD BDA Invitrogen D1956; diluted in 0.9% NaCl) were used as retrograde and anterograde tracers ...
-
bioRxiv - Cell Biology 2023Quote: ... X-biotin-PE [N-((6-(biotinoyl)amino)hexanoyl)-1,2-dihexadecanoylsn-glycero-3-phosphoethanolamine] was obtained from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Genetics 2021Quote: ... RNA was extracted from control and CRISPR-Cas9 targeted Calu-3 cells (N = 3 biological replicates, with 3 technical replicates per experiment per condition) and prepared using Trizol Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... 3-(N-maleimidylpropionyl)biocytin (MBP) was obtained from Invitrogen and the HRP-conjugated antibody from eBioscience ...
-
bioRxiv - Biochemistry 2020Quote: ... N-cyclohexyl-3- aminopropanesulfonic (CAPS) was from Acros Organics, 2-(N-Morpholino)ethanesulfonic acid (MES ...
-
bioRxiv - Synthetic Biology 2020Quote: ... N-cyclohexyl-3-aminopropanesulfonic (CAPS) was from Acros Organics, 2-(N-Morpholino)ethanesulfonic acid (MES ...
-
bioRxiv - Cell Biology 2021Quote: ... N-hydroxysulfosuccinimide (sulfo-NHS) and 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) from Thermo Scientific were dissolved in 18 MOhm DDW immediately before use ...
-
bioRxiv - Microbiology 2019Quote: ... and 3-6 μl Lipofectamin 2000 (Life Technologies). See the Supplemental Information for detailed description.
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... and N-((6-(biotinoyl)amino)hexanoyl)-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (biotin-X DHPE; Molecular Probes, Life Technologies). Planar bilayers were formed from 200-nm liposomes in channels of a PDMS flow-cell using vesicle spreading method (36) ...
-
bioRxiv - Microbiology 2022Quote: ... and N-((6-(biotinoyl)amino)hexanoyl)-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (biotin-X DHPE; Molecular Probes, Life Technologies). Planar bilayers were formed from 200-nm liposomes in channels of a PDMS flow-cell using vesicle spreading method (36) ...
-
bioRxiv - Neuroscience 2024Quote: ... n=6) before being perfused intravenously with fluorescent Texas Red 40 kDa Dextran (3 mg/kg; D1829, Fisher Scientific) as described in previous studies (25,26 ...
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...
-
bioRxiv - Bioengineering 2020Quote: Before staining with either 5-bromo-4-chloro-3’-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, ThermoFisher) or Alizarin Red S (ARS ...
-
bioRxiv - Microbiology 2024Quote: ... containing 100 mg/ml of X-gal (5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Thermofisher) to confirm CFU/ml counts.
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Biochemistry 2019Quote: ... and N-ethyl-N-(3-dimethyl aminopropyl) carbodiimide hydrochloride (EDC) (Thermo Fisher Scientific, USA) were mixed in a reaction flask ...
-
bioRxiv - Neuroscience 2020Quote: Tissue sections from male (n = 3) and female (n = 3) rats were mounted on subbed glass slides (Fisher brand Superfrost Plus, Fisher Scientific, Hampton, NH, USA) and desiccated overnight (~16 h ...
-
bioRxiv - Genomics 2022Quote: ... 3 μM CHIR99021 (Stemgent) and 0.5× N-2 Supplement (Gibco)) which was changed daily for the cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-GAAGUCACAACAGAGUGCAGGCAAA-3’) and an appropriate control (Cat. N° 12935300 - Invitrogen) using Lipofectamine RNAiMAX reagent (Invitrogen ...
-
bioRxiv - Neuroscience 2019Quote: ... post-axotomy cultures were loaded with lipophilic dye N-(3-trimethylammoniumpropyl) -4-(6-(4-(diethylamino) phenyl) hexatrienyl)pyridinium dibromide (FM 5–95; Invitrogen) using KCl mediated depolarization as described previously (Taylor et al ...
-
bioRxiv - Cell Biology 2019Quote: ... FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) was purchased from Invitrogen. Rapamycin was purchased from LC Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... Streptomyces hyphae were incubated with 0.5 mg/ml FM 4-64 Dye (N-(3-Triethylammoniumpropyl)24-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Molecular Probes) for 15 min in the dark ...
-
bioRxiv - Systems Biology 2022Quote: ... Transcriptomics using the isolated mRNA from liver tissues (0, 2, 4, 6, 8 and 10 weeks; n=3 per time point) was performed by Affymetrix GeneChip®Mouse Gene 2.0 ST Arrays (902118) ...
-
bioRxiv - Neuroscience 2023Quote: Cultured neurons were incubated for 1 min with fluorescent dye N-(3-triethylammonium-propyl)-4-(6-(4-diethylamino)phenyl)-hexatrienyl)pyridinium dibromide (FM4-64; 4 µM; Invitrogen) and loaded by stimulation (10 Hz ...