Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 TERT BUTYL PYRIDINE 3 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... and tert-butyl hydrogen peroxide (ThermoFisher) were used as standards for the extra- and intracellular assays ...
-
bioRxiv - Microbiology 2023Quote: ... tert-Butyl hydroperoxide (tBOOH – Acros Organics) and diamide (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 3) Oxidative stress induction using 70 μM tert-Butyl hydroperoxide (Thermo Fisher 180345000) for 16-18 h ...
-
bioRxiv - Bioengineering 2022Quote: ... di-tert-butyl dicarbonate (Boc2O, 99%, Fisher Scientific) (1.6:1 to HA-TBA repeat unit ...
-
bioRxiv - Immunology 2021Quote: ... tert-butyl hydrogen peroxide was obtained from ACROS Organics; Oxidized and reduced L-Glutathione were obtained from Alfa Aesar ...
-
bioRxiv - Immunology 2023Quote: ... Di-tert-butyl peroxide (DTBP) crosslinker (#20665, Thermo Fisher Scientific) was added for 5 minutes at 37 °C to a final concentration of 2.5 mM ...
-
bioRxiv - Biochemistry 2023Quote: ... methyl tert-butyl ether and 2-propanol were from Thermo Fisher Scientific (Pittsburg ...
-
bioRxiv - Cell Biology 2023Quote: ... Tert-butyl hydroperoxide (TBHP, 70% solution in water) was obtained from Acros Organics and diluted in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... The crude peptide was precipitated in tert-butyl methyl ether (TBME, ACROS Organics, AC378720025). After the supernatant was removed by centrifugation ...
-
bioRxiv - Biophysics 2019Quote: ... Cleaved peptides were precipitated from ice-cold methyl tert-butyl ether (MTBE; Thermofisher Acros Organics, Geel, Belgium). After washing and collection by centrifugation crude peptides were dissolved in 20% (v/v ...
-
bioRxiv - Biophysics 2019Quote: ... Cleaved peptides were precipitated from ice-cold methyl tert-butyl ether (MTBE; Thermofisher Acros Organics, Geel, Belgium). After washing and collection by centrifugation crude peptides were dissolved in 20% (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM disuccinimidyl suberate (DSS) or 2 mM tert-butyl disuccinimidyl phenyl phosphonate (tBu-PhoX)(Thermo Fisher Scientific) in DMSO was added to the solution and incubated for 1 hr at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... N,N-dimethyl formamide (DMF) and water and HPLC grade methyl tert-butyl ether (MTBE) were obtained from Thermo Fisher used throughout ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The lysate was then further decolorized by gently shaking against an equal volume of Methyl tert-Butyl Ether twice and then Hexanes (Fisher Scientific). The aqueous layer was then recovered ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then treated with hexamethyldisilazane-trimethylchlorosilane-pyridine solution (3:1:9; ThermoFisher) for 20 min at 110°C ...
-
bioRxiv - Systems Biology 2019Quote: ... in pyridine (Acros Organics) and then by N-methyl-N-(trimethylsilyl ...
-
bioRxiv - Cell Biology 2022Quote: ... TERT (ThermoFisher #Bt03239211), and CDK4 (ThermoFisher #Bt03231354) ...
-
bioRxiv - Biochemistry 2020Quote: ... in pyridine (Thermo Fisher Scientific, 25104) at 60 °C for 1 h ...
-
bioRxiv - Bioengineering 2022Quote: ... and 4-(dimethylamino)pyridine (Fisher Scientific) (3:1 to HA-TBA repeat unit ...
-
bioRxiv - Molecular Biology 2019Quote: ... N/Tert-1 and N/Tert-1+HPV16 cells were grown in K-SFM (Invitrogen) with 1% (v/v ...
-
bioRxiv - Bioengineering 2023Quote: ... and then Pyridine (0.02 mol; Fisher Scientific) was injected to the mixture ...
-
bioRxiv - Biochemistry 2023Quote: ... in pyridine (CAS#25104, Thermo scientific, Rockford, IL) and stirred at 90 ° C for 1.5 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TERT TaqMan Assay (Applied Biosystems, Hs00972650_m1) were used to measure TERT expression ...
-
bioRxiv - Cancer Biology 2023Quote: ... or TERT (Applied Biosystems, cat. no. 4403316) as the reference assay ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Biochemistry 2019Quote: ... 30×106 cells were transfected with 15 μg of TERT plasmid (3xFLAG- or 3xFLAG-HaloTag-TERT) and 60 μg of pSUPER-hTR using 150 μl of Lipofectamine 2000 (Invitrogen) in a total volume of 7.5 ml of OPTI-MEM (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and butylparaben (Butyl 4-hydroxybenzoate, BP; Acros Organics, CAT: 403571000). Chemicals were dissolved in ethanol (EtOH ...
-
bioRxiv - Microbiology 2019Quote: ... and 3-6 μl Lipofectamin 2000 (Life Technologies). See the Supplemental Information for detailed description.
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... then adding 15 µL of methoxy amine in pyridine (MOX) (Thermo Fisher) and incubating at 40°C for 90 min ...
-
bioRxiv - Neuroscience 2021Quote: ... DiIC18(3) dye (6 mg; Invitrogen, Carlsbad, CA, USA) was dissolved in 99.5% methylene chloride (300 μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Genetics 2021Quote: Human TERT cDNA39 was cloned into the gateway pDONR221 plasmid (Invitrogen). TERT variants were generated using the Q5 Site-Directed Mutagenesis Kit (NEB ...
-
bioRxiv - Genomics 2020Quote: ... 20x human TERT TaqMan™ Copy Number Reference Assay (ThermoFisher 4403316) as internal reference control ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the reference assays for TERT (Thermo Fisher Scientific cat # 4403316) and RNase P (Thermo Fisher Scientific cat # 4403326 ...
-
bioRxiv - Immunology 2024Quote: ... N/TERTs were grown in Keratinocyte-SFM medium (ThermoFisher #17005-042) supplemented with 30 μg/ml bovine pituitary extract ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Methanol (CH3OH) 99.8% and pyridine 99.5% were purchased from Acros Organics (Geel, Belgium). 1,2-Distearoyl-sn-Glycero-3-Phosphocholine (DSPC ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2019Quote: ... TERT-RPE-1 cells were cultured in DMEM-F12 (Gibco 10565-018) supplemented with 10% FBS (Gibco 10270106).
-
bioRxiv - Cell Biology 2019Quote: ... Human TERT-RPE cells were cultured in DMEM+F12 (1:1) (Invitrogen) containing 10% FBS ...
-
bioRxiv - Neuroscience 2023Quote: ... and Tert was used as the reference gene (VIC labeled: ThermoFisher, 4403316).
-
bioRxiv - Cell Biology 2024Quote: ... HEKn and N/TERT keratinocytes were routinely cultured in EpiLife medium (ThermoFisher Scientific Cat#MEPI500CA ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).