Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 PHENYL 1 3 DIHYDRO INDOL 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 4’,6’-diamino-2-fenil-indol (DAPI) (1:25000, Life Technologies) and Phalloidin (Alexa 488 ...
-
bioRxiv - Microbiology 2023Quote: ... 4’,6’-diamino-2-fenil-indol (1:25000) (DAPI, Life Technologies, USA) and Phalloidin (1:500 ...
-
bioRxiv - Microbiology 2023Quote: ... The 4’,6’-diamino-2-fenil-indol (DAPI) (1:2500, Life Technologies) and the Phalloidin (Alexa-488 ...
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Developmental Biology 2023Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenyl-indole (DAPI, Life Technologies) and sections were examined with a confocal laser scanning microscope (Carl Zeiss Inc ...
-
bioRxiv - Physiology 2019Quote: ... and HDMBOA (4,7-dimethoxy-2-{[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy}-3,4-dihydro-2H-1,4-benzoxazin-3-one)) (Block et al., 2019) (Yang et al., 2019) were quantified using HPLC (Thermofisher scientific) which was coupled with MS (UltiMate 3000 HPLC ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 0.2 mM 1-phenyl-2-thiourea (Acros Organics) for 24 h from 1 to 2 dpf.
-
bioRxiv - Cell Biology 2023Quote: ... For nuclear staining 0.5µg/µL of DAPI (4’, 6-diamidino-2-phenylindole, dihydro-chloride, Invitrogen. Cat. No.: D3571) was added along with secondary antibody ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-[p-(6-phenyl)-1,3,5-hexatrienyl] phenylpropionic acid was purchased from Molecular Probes (Eugene, OR, USA) and 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphocholine (SLPC ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Developmental Biology 2024Quote: Strains were subjected to auxin (Thermo Fisher Alfa Aesar Indol-3-Acetic Acid #A10556) by incorporation into NGM or HGM plates at a final concentration of 4mM ...
-
bioRxiv - Plant Biology 2022Quote: ... N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM 4-64; 50 μM) (Invitrogen) or propidium iodide (PI ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... supplemented with 0.2 mM 1-phenyl-2-thiourea (10107703, Acros Organics) to inhibit melanogenesis ...
-
bioRxiv - Neuroscience 2019Quote: ... post-axotomy cultures were loaded with lipophilic dye N-(3-trimethylammoniumpropyl) -4-(6-(4-(diethylamino) phenyl) hexatrienyl)pyridinium dibromide (FM 5–95; Invitrogen) using KCl mediated depolarization as described previously (Taylor et al ...
-
bioRxiv - Cell Biology 2019Quote: ... FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) was purchased from Invitrogen. Rapamycin was purchased from LC Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... Streptomyces hyphae were incubated with 0.5 mg/ml FM 4-64 Dye (N-(3-Triethylammoniumpropyl)24-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Molecular Probes) for 15 min in the dark ...
-
bioRxiv - Neuroscience 2023Quote: Cultured neurons were incubated for 1 min with fluorescent dye N-(3-triethylammonium-propyl)-4-(6-(4-diethylamino)phenyl)-hexatrienyl)pyridinium dibromide (FM4-64; 4 µM; Invitrogen) and loaded by stimulation (10 Hz ...
-
bioRxiv - Cell Biology 2019Quote: The staining of limiting membrane of the yeast vacuole was achieved with FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Invitrogen). Cells were grown to early-log phase in appropriate medium ...
-
bioRxiv - Cell Biology 2024Quote: ... hansenii cells were concentrated 10x in 200 μL YPD containing 40 μM FM4-64 dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) dye (Invitrogen™) to label endosomes for 8 minutes ...
-
bioRxiv - Biophysics 2021Quote: ... Membranes were stained with 1-(4-trimethylammoniumphenyl)-6-phenyl-1,3,5-hexatriene p-toluenesulfonate (TMA-DPH; Molecular Probes) at a final concentration of 100 μM and the cells were then immobilized on a 2% agarose pad made with sporulation buffer covered with a no.1.5 coverslip ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatants were aspirated and pellets were resuspended in 3-5 µL of 1X PBS containing 0.02 mM 1-(4-(trimethylamino) phenyl)-6-phenylhexa-1,3,5-triene (TMA-DPH)(Invitrogen).Cells were mounted on glass slides with polylysine-treated coverslips ...
-
bioRxiv - Neuroscience 2022Quote: ... Then one drop of DAPI (4′, 6-diamidino-2-phenylindole, ThermoFisher Scientific) was added to the suspension and 25 nuclei were sorted by Aria II (BD ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... potential was examined using 5,6-dichloro-2-[3-(5,6-dichloro-1,3-diethyl-1,3-dihydro-2H-benzimidazol-2-ylidene)-1propenyl]-1,3-diethyl-,iodide (JC-1 dye) (Life Technologies, USA) as a probe ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Cell Biology 2024Quote: ... we used 1-(4-Trimethylammoniumphenyl)-6-Phenyl-1,3,5-Hexatriene p-Toluenesulfonate (TMA-DPH; Thermofisher Scientific Cat. No. T204). Yeast cells were stained with 0.5µM TMA-DPH ...
-
bioRxiv - Bioengineering 2023Quote: ... in anE3 medium supplemented with 30 mg/ml 1-phenyl-2-thiourea (PTU, Acros Organics) from 24 hpf ...
-
bioRxiv - Cell Biology 2022Quote: ... dihydro-chloride (DAPI) (Invitrogen. Cat. Nº: D3571) at 0.5 µg/µl ...
-
bioRxiv - Genetics 2022Quote: ... The styryl dye N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM4-64, 514/670 nm absorption/emission Invitrogen™, Waltham, Massachusetts) was used at a final concentration of 16.5 μM in ddH2O from a 16.5 mM stock solution in DMSO ...
-
bioRxiv - Microbiology 2022Quote: The PfHDAC1-2xFKBP-GFP knockin NF54 line parasitized RBCs (mock or 100 nM dihydro artemisinin treated from ∼21-24 HPI/3 hours) were crosslinked using 1% formaldehyde (Thermo Scientific, 28908) for 10 mins at RT ...
-
bioRxiv - Microbiology 2020Quote: The lipophilic fluorescent membrane probe 1-(4-Trimethylammoniumphenyl)-6-Phenyl-1,3,5-Hexatriene p-Toluenesulfonate (TMA-DPH) (Themo Fisher Scientific) was used to assess EV associated lipids ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μg/ml L-(tosylamido-2-phenyl ethyl) chloromethyl ketone (TPCK)-treated trypsin (Thermo Scientific Pierce), and 1x antibiotic-antimycotic (Corning) ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Developmental Biology 2024Quote: ... in facility water (2-month-old fish) or an E3 solution supplemented with 0.2 mM 1-phenyl-2-thiourea (PTU; Acros Organics) (larvae) ...
-
bioRxiv - Microbiology 2022Quote: ... per well were distributed in Ibidi® µ-slide 8-well chambered coverslips and stained with 0.8 μM of the membrane specific fluorescent styryl dye N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM4-64; Thermo Fisher Scientific, Waltham, MA, USA) in the presence of 0 μM (control) ...
-
bioRxiv - Plant Biology 2019Quote: ... pollinated stigma was incubated in FM™ 4-64 Dye (N-3-Triethylammoniumpropyl-4-6-4-Diethylamino Phenyl Hexatrienyl Pyridinium Dibromide, Life Technologies T3166, 8.23 μM) for five minutes and subsequently washed in 1/2 Murashige and Skoog basal medium containing 10 % (w/v ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mM Phenyl-methylsulfonyl fluoride (36978, Thermo Fisher, Australia), 1X protease inhibitor cocktail (cat ...
-
bioRxiv - Cell Biology 2021Quote: ... PDMPO [2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-amino-carbamoyl)methoxy)-phenyl)oxazole] (ThermoFisher Scientific, USA) was added to a final concentration of 330 µM ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with FluorSave (Calbiochem).
-
bioRxiv - Cell Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with a FluorSaveTM reagent (Merck-Millipore).
-
bioRxiv - Cancer Biology 2023Quote: ... anti-CD11a (1:50, IBL-6/2, Invitrogen), and FITC anti-PD-1 (1:50 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Medium was replaced daily from 8 hpf and supplemented with 0.2 mM 1-phenyl-2-thiourea (10107703, Acros Organics) to inhibit melanogenesis ...
-
bioRxiv - Developmental Biology 2024Quote: ... Larvae were then kept at 28.5°C with fresh E3 medium supplemented with 0.2 mM 1-phenyl-2-thiourea (10107703, Acros Organics). Around 3-4 hours after heat-shock ...
-
bioRxiv - Cell Biology 2020Quote: ... then stained for one minute with 30 ng/mL 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, D1306) in 1x PHEM ...
-
bioRxiv - Cell Biology 2021Quote: ... then stained for one minute with 30 ng/mL 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen D1306) in 1x PHEM ...