Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Oxabicyclo 3.1.0 hexane 3 carboxylicacid ethylester 1α 3α 5α 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Tetramethylrhodamine ethylester perchlorate (TMRE, Molecular Probes, Inc., Eugene OR, USA) was prepared at a concentration of 1 mM in DMSO and stored at -20°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 2- & 3-methyl pentane and n-hexane (Thermo Scientific, Waltham, MA, USA). Reported compounds detected by the GC-MS were confirmed by matching retention times and mass–charge (m/z ...
-
bioRxiv - Biochemistry 2023Quote: ... Anti-GSK-3α/β (44610) was from Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... hexanes (>99.9%; Thermo Fisher Scientific, Certified ACS), ether (anhydrous ...
-
bioRxiv - Microbiology 2021Quote: ... hexane (Fisher Scientific, various methylpentanes 4.2%, ≥98.5%) isopropyl ß-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Cell Biology 2024Quote: ... mixed with Hexanes (Fisher Scientific H292-1) in a 30% vol/vol ratio ...
-
bioRxiv - Physiology 2019Quote: ... PGC-1α (Life Technologies PA572948), PPARγ (Santa Cruz Biotechnology clone E-8 ...
-
bioRxiv - Immunology 2023Quote: ... T cells were loaded with 500 nM MitoTracker DeepRed and 2 nM Tetramethylrhodamin-Ethylester (TMRE) (both Invitrogen). As control for TMRE ...
-
bioRxiv - Molecular Biology 2022Quote: MS data were pre-processed by importing the MS data in Compound Discoverer 3.1.0 (Thermo Scientific). This involves extracting peaks ...
-
bioRxiv - Genomics 2021Quote: ... 1 mL of hexane (Fisher Scientific; H303-4) followed by 1 mL of deionized water was added to each sample ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... All compounds were diluted in hexane (Fisher Scientific, USA).
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... 500 μL n-Hexane (97+ %; Acros Organics, Geel, Belgium) was added to trunk samples to remove the interference of precipitated lipids ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 400 μL of n-hexane (Acros Organics; 160780010) in a capped mass spec autosampler vial (Microliter ...
-
bioRxiv - Microbiology 2023Quote: ... and 400 µL of n-hexane (Acros Organics; 160780010) in a capped mass spec autosampler vial (Microliter ...
-
bioRxiv - Cancer Biology 2023Quote: ... the EF-1α promoter sequence from the L4/R1 EF-1α promoter donor vector (ThermoFisher Scientific, cat. A11146) was replaced with a 194bp sequence containing multiple restriction digestion sites to facilitate simple restriction cloning of any desired promoter ...
-
bioRxiv - Immunology 2022Quote: ... IL-1α and TNF (eBioscience or Invitrogen) were used ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... oceanicus crickets were immersed in HPLC-grade hexane (Fisher Scientific) for 5 minutes to remove long-chain waxy hydrocarbons that coat the insect cuticle ...
-
A sound strategy for homology modeling-based affinity maturation of a HIF-1α single-domain intrabodybioRxiv - Biochemistry 2020Quote: The HIF-1α-PAS-B domain was coated at 3 μg/ml onto 96-well microtiter plates (Thermo Fisher Scientific) and incubated overnight at 4 °C ...
-
bioRxiv - Immunology 2020Quote: ... IL-1α (Thermo Fisher Scientific, clone ALF-161), or IL-1β (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... IL-1α (1:50, Thermo Fisher PA5-89037), IL-1β (1:500 ...
-
bioRxiv - Microbiology 2019Quote: ... and 3-6 μl Lipofectamin 2000 (Life Technologies). See the Supplemental Information for detailed description.
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and n-hexane and Nitrogen (N2) were all obtained from Fisher Scientific, Leicestershire ...
-
bioRxiv - Neuroscience 2021Quote: ... DiIC18(3) dye (6 mg; Invitrogen, Carlsbad, CA, USA) was dissolved in 99.5% methylene chloride (300 μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2020Quote: C2C12 myotubes were transduced with PGC-1α FL at MOI 3 and nuclear extract was prepared with NE-PER(tm) Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, #78835). Pull-down and negative control comprised 350 μg of protein from nuclear extract ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Microbiology 2021Quote: ... all nectars were first defatted through a hexane (Thermo Fisher Scientific, Waltham, MA) extraction ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Bioengineering 2022Quote: ... a 33% solution of PDMS mixture in hexane (Thermo Fisher Scientific, Waltham, MA, USA) was spin-coated on a silicon wafer at 4000 rpm for 2 min to form a thin adhesive layer ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then introduced to a 2 ml vial containing 100 μl hexane (Thermo Scientific) with n-C19 alkanes (10 ng/μl ...
-
bioRxiv - Plant Biology 2024Quote: ... then redissolved in 100 μL hexane for GC-MS (ISQ-7000, Thermo Scientific, USA). The GC run sequence starts with an initial hold at 110 °C for 2 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
Activation of glucocorticoid receptor signaling inhibits KSHV-induced inflammation and tumorigenesisbioRxiv - Cancer Biology 2023Quote: ... ELISA was performed using the rat IL-1α ELISA Kit (Invitrogen, BMS627) and IL-1Ra ELISA Kit (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng/ml IL-6 and 10 ng/ml IL-3 (Gibco). Inpp4b+/+ and Inpp4b-/- LSK were each retrovirally transduced with pMSCV-MLL-AF9-IRES-mVenus ...
-
bioRxiv - Microbiology 2023Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Immunoprecipitations were performed using 5μg of anti-HIF-1α (clone PA3-16521, Invitrogen) or rabbit IgG as a control ...
-
bioRxiv - Biochemistry 2023Quote: HIF-1α was evaluated using a HIF-1 Alpha ELISA Kit (Invitrogen™). Procedure steps were followed according to the manufacturer’s instructions and results were monitored at 450 nm ...
-
bioRxiv - Neuroscience 2024Quote: ... IL-1β and IL-1α signal was amplified with Tyramide SuperBoostTM (Thermo Fisher) using biotinylated horse–anti-goat IgG (7.5 µg/mL ...
-
bioRxiv - Microbiology 2021Quote: ... followed by incubation in a 100° C sand bath and back-extraction with hexane (Fisher Scientific). Sample extracts were concentrated to 0.3 ml under a gentle stream of N2 at 35°C ...