Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 FLUOROQUINOLINE 2 3 DICARBOXYLIC ACID DIETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 2,4-Pyridine Dicarboxylic Acid (2,4-PCA) is purchased from Acros Organics (New Jersey, Catalog number 101860010). JIB-04 is purchased from Sigma-Aldrich (St ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were anchored with succinimidyl ester of 6-((Acryloyl)amino) hexanoic acid (AcX) (Thermofisher) in PBS (0.1mg/ml ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... potential was examined using 5,6-dichloro-2-[3-(5,6-dichloro-1,3-diethyl-1,3-dihydro-2H-benzimidazol-2-ylidene)-1propenyl]-1,3-diethyl-,iodide (JC-1 dye) (Life Technologies, USA) as a probe ...
-
bioRxiv - Immunology 2020Quote: ... then labelled with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceinacetoxymethyl ester (Life Technologies, UK). Neutrophils were then added to wells under normoxia or hypoxia ...
-
bioRxiv - Genetics 2023Quote: ... each coverslip was incubated in 3 μl fura-2 acetoxymethyl (AM) ester (Invitrogen) in 1X HBSS containing 5 mg/ml BSA (Sigma- Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... 1,2-Bis(2-aminophenoxy)ethane-N,N,N’,N’-tetraacetic acid tetraacetoxymethyl ester (BAPTA-AM, Invitrogen), calcium Ionophore A23187 (Sigma) ...
-
bioRxiv - Genetics 2019Quote: FluoZin-3 acetoxymethyl ester (Molecular Probes F24195) was reconstituted in dimethylsulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2023Quote: ... zebrafish embryos were anesthetized in 0.02% 3-aminobenzoic acid ethyl ester (tricaine) and fixed in PBS (150mM NaCl, 10mM PO43-, pH 7.4) (Invitrogen) with 4% paraformaldehyde (PFA ...
-
bioRxiv - Immunology 2020Quote: ... and Alexa Fluor 647 Carboxylic Acid succinimidyl Ester (Invitrogen). Antibody labelling reactions were performed by incubating a mixture of secondary antibody ...
-
bioRxiv - Cell Biology 2023Quote: ... and Alexa Fluor 647 Carboxylic Acid succinimidyl Ester (Invitrogen). Antibody labelling reactions were performed as previously reported (Borgman et al. ...
-
bioRxiv - Immunology 2020Quote: ... The dyes were purchased as NHS ester derivatives: Alexa Fluor 405 Carboxylic Acid Succinimidyl Ester (Invitrogen), Cy3 mono-Reactive Dye Pack (GE HealthCare) ...
-
bioRxiv - Neuroscience 2023Quote: ... brains were washed trice with PBS for 5 min and free amines were anchored with 0.1mg/mL succinimidyl ester of 6-((Acryloyl)amino)hexanoic acid (Acryloyl-X, SE, Life Technologies) in PBS at 4°C overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... the conversion of non-fluorescent 2’,7’-bis-(2- carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF AM) (Invitrogen, Waltham, MA) into a pH sensitive fluorescent indicator by the intracellular esterase was used to measure the pH ...
-
bioRxiv - Molecular Biology 2021Quote: ... 250 ml diethyl ether (Fisher Scientific), 30 ml TEA ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 250 ml diethyl ether (Fisher Scientific), 30 ml TEA and 1.6 ml acetone saturated with NaClO4 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... treated with Diethyl Pyrocarbonate (Fisher Scientific) (i.e. ...
-
bioRxiv - Cell Biology 2023Quote: ... The dyes used for labelling were NHS ester derivatives: Alexa Fluor 405 Carboxylic Acid Succinimidyl Ester (Invitrogen), Cy3 mono-Reactive Dye Pack (GE HealthCare) ...
-
bioRxiv - Microbiology 2023Quote: ... Substrate 2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS; Thermo Fisher Scientific) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... 2’,7’-Bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) was purchased from Molecular Probes (Invitrogen, Carlsbad, CA, USA). Fluorescein isothiocyanate (FITC)- and tetramethylrhodamine (TRITC)-conjugated goat anti-mouse and rabbit IgG antibodies were purchased from Jackson ImmunoResearch (West Grove ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Molecular Biology 2021Quote: ... and FURA 2-AM (Fura-2-acetoxymethyl ester) from Invitrogen, CA ...
-
bioRxiv - Plant Biology 2022Quote: ... Each sample was incubated with 50 µm of 2’,7’-Bis-(2- carboxyethyl)-5-(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM; Molecular Probes, Eugene, OR) at 28°C ...
-
bioRxiv - Bioengineering 2019Quote: ... diethyl pyrocarbonate (DEPC) water (Invitrogen, Carlsbad, CA), and human whole blood collected in sodium citrate (Innovative Research ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 2 μM Fura-2 acetoxymethyl ester (Fura-2 AM; ThermoFisher Scientific) and 0.01% pluronic acid (Merck ...
-
bioRxiv - Cell Biology 2023Quote: Tubulin was labelled with (5(6)-TAMRA Succinimidyl Ester (Invitrogen, C1171) for fluorescence microscopy assays according to published methods (Consolati et al ...
-
bioRxiv - Neuroscience 2022Quote: Fura-2 pentaacetoxymethyl ester (fura-2/AM) was from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Developmental Biology 2023Quote: ... Bis-(1,3-diethylthiobarbituric acid) trimethine oxonol (DiSBAC, relative polarization) and CoroNa green, acetoxymethyl ester (CoroNa, sodium ions) were purchased from Invitrogen (Waltham, MA).
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2023Quote: The ROS dye assay was performed using Di(Acetoxymethyl Ester) (6-Carboxy-2’,7’-Dichlorodihydrofluorescein Diacetate) ROS dye (Invitrogen, D23844), a fluorogenic dye that is converted to 6-CarboxyFluorescein ...
-
bioRxiv - Pathology 2021Quote: ... pentaacetoxymethyl ester (Fluo-3/AM) (Molecular Probes, Eugene, OR, USA), which was observed with the laser-scanning confocal microscopy (LSCM ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-[p-(6-phenyl)-1,3,5-hexatrienyl] phenylpropionic acid was purchased from Molecular Probes (Eugene, OR, USA) and 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphocholine (SLPC ...
-
bioRxiv - Cell Biology 2019Quote: ... DMF and diethyl Ether were from Fisher scientific. Fmoc-Dab(Alloc)-OH was from Bachem AG ...
-
bioRxiv - Microbiology 2023Quote: ... Diethyl Pyrocarbonate (DEPC)-treated water (Invitrogen™, #4387937); Paraformaldehyde (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Cardiomyocytes were loaded with Fura-2 acetoxymethyl ester (Fura-2 AM; Invitrogen) as described previously.28 After Fura-2 loading ...
-
bioRxiv - Immunology 2022Quote: ... 100 μg of HDM or OVA were reconstituted in PBS with 0.1 M sodium bicarbonate at 1 mg/ml and mixed with 18 μg Texas Red-succinimidyl ester or 36 μg 5,(6)-TAMRA-succinimidyl ester (Life Technologies), respectively ...
-
bioRxiv - Biophysics 2022Quote: ... Fura-2-acetoxymethyl ester (Fura-2AM, Molecular Probes; Invitrogen), in culture medium for 25 min at 37 °C ...
-
bioRxiv - Biophysics 2022Quote: ... Fura-2-acetoxymethyl ester (Fura-2AM, Molecular Probes; Invitrogen), in culture medium for 25 min at 37 °C ...
-
bioRxiv - Immunology 2020Quote: ... plates were incubated with 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) substrate (ABTS, Thermo Fisher Scientific) for 15 min at RT shielded from light and absorbance was measured at optical density (OD ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 L-malic acid and 20 μM tetramethylrhodamine methyl ester (TMRM, Thermo Fisher) for 10 minutes ...
-
bioRxiv - Physiology 2023Quote: ... with or without 0.1uM 6-Hydroxyhexanoic acid (6-HHA, ThermoFisher, B24857.03).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Myocytes were then loaded with Fura-2 acetoxymethyl ester (Fura-2 AM; Invitrogen) as described previously (Batiste et al. ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Microbiology 2019Quote: ... Coverslips were stained with 300 nM 4’,6-diamidino-2-phenylindole nucleic acid stain (DAPI; Invitrogen) in PBS for 5 min followed by washing three times in PBS at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Zoology 2019Quote: ... containing 5 µM Fura-2 acetoxymethyl ester (Molecular Probes, Invitrogen) for 30 min at room temperature ...