Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Dodecyne 5 8 diol 2 5 8 11 tetramethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... P-gp-overexpressing subline KB-8-5-11 were maintained in DMEM (Thermofisher catalog #11965) with 10% FBS and 1% penicillin/streptomycin at 37°C in 5% CO2 ...
-
bioRxiv - Systems Biology 2021Quote: ... 5 mM EDTA pH 8 (Invitrogen 15575), and 100 mM Tris-HCl pH 7.2 (Sigma T2069 ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Neuroscience 2022Quote: ... 8 μl of 5% hydroxylamine (Thermo Fisher Scientific) was added to quench the reaction ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Cell Biology 2021Quote: ... 5 ml PCIA (Phenol:Cholorform:Isoamyl alcohol pH 8) (Thermo Fisher) were added and samples vortexed ...
-
bioRxiv - Bioengineering 2022Quote: ... 5% CO2 and 5% O2 in Essential 8 medium (Thermo Fisher Scientific, Waltham, MA) on Matrigel- (BioStrategy ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were washed then incubated in 8 μM of the ROS sensitive probe 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate acetyl ester (CM-H2DCFDA) (Molecular Probes, Eugene Oregon), for 45 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... The injected individuals were kept at 18°C for 5 to 8 days in 6-well-plates (Nunc multidish no ...
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Developmental Biology 2021Quote: ... 5% CO2 in Essential 8 medium (Cat. # A1517001, Thermo Fisher Scientific) and passaged every 3 – 4 days using Versene (Cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µL 8 mg/mL Yeast tRNA (Thermo Fisher Scientific, 15401011) and 100 µL DIG Easy Hyb (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... Alexa 488 conjugated Claudin-5 (1:500; Invitrogen, 35-358-8), rabbit anti-CCL2 (1:500 ...
-
bioRxiv - Bioengineering 2020Quote: ... 2.5 μM of CellTracker™ Orange 5-(and-6)-(((4-chloromethyl)benzoyl)amino)tetramethyl-rhodamine CMTMR (Molecular Probes, C2927) was used to label iNeuron cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... with IVT mix (0.5 µL Ribolock inhibitor, Invitrogen, 2 µL T7 polymerase buffer, NEB, 8 µL rNTP mix, 2 µL T7 polymerase, Invitrogen). DNA was removed by addition of 1 µL turbo DNase (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... 293T cells were plated in 6 well plates at 8 x 10^5 cells / well with DMEM / 10% FBS / NEAA / Pen-Strep (Gibco). Cells growing at ∼70-80% confluency were transfected with 1 μg of the desired expression plasmid (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... Larvae were anesthetized with diethyl-ether for 5-8 minutes (Acros Organics) before mounted in glycerol on top of a thin patch of agarose ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Pro-inflammatory cytokine (IL-8) and (IL-6) release was determined using the IL-6 and IL-8 ELISA kit (Invitrogen) according to the manufacturer’s instructions (ThermoFisher).
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cancer Biology 2021Quote: ... The fluorescent reaction was measured every 40 sec for 8 min and subsequent every 5 min for 6 times using a microplate reader (Thermo Scientific) with enzyme kinetics model ...
-
bioRxiv - Neuroscience 2023Quote: ... The injected individuals were kept at 18°C for 5 to 8 days in 6-well-plates (Nunc multidish no. 150239, Thermo Scientific) and then cultured at 22°C until sexual maturity ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human embryonic stem cell line H9 was cultured on the 6-well plate coated with the Vitronectin (5 μg/ml) and in the Essential 8 Flex medium (both Thermo Fisher). Cells were split every 7 days using 5-minute incubation with 0.5 mM EDTA-PBS (Thermo Fisher ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Three tadpoles per stage (1, 2, 5, 7, and 8 weeks after hatching) were fixed in an RNAlater (Ambion) solution ...
-
bioRxiv - Biochemistry 2022Quote: ICabs A4 and B7 were labelled with NHS-Rhodamine (5/6-carboxy-tetramethyl-rhodamine succinimidyl ester, ThermoFisher Scientific (catalogue no. 46406)) as described by the manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... followed by incubation for 8 min using 5 μM CellTrace Violet dye (Invitrogen). Following fluorescent labeling ...
-
bioRxiv - Microbiology 2022Quote: Vero cells were cultured for 5−8 passages in DMEM medium (Gibco, USA) with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Neuroscience 2022Quote: ... coated 6-well plates in Essential 8 medium (Gibco) and were passaged every 3 days using Versene (EDTA-based ...
-
bioRxiv - Bioengineering 2022Quote: ... The 24-well plates with infected BHK-21 cells were overlaid with 1 ml of 0.8% methylcellulose in complete DMEM medium with 2% FBS and incubated for 5 days in a cell culture incubator (Thermo Fisher Scientific, 37°C and 5% CO2). Plaques were fixed and developed with staining reagent (1% crystal violet in 1:1 methanol/acetone solution ...
-
bioRxiv - Bioengineering 2020Quote: ... The cells were passaged at a density of 1:2 to 1:8 after reaching ~80% confluency by detaching with 5 mM EDTA in PBS (Invitrogen 15575-038 diluted in sterile 1X PBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 - diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Cell Biology 2019Quote: ... 5 and 8 were dissociated into single cells with 0.05% Trypsin-EDTA (Invitrogen, 25300062), counted by Countstar (BioTech ...
-
bioRxiv - Microbiology 2022Quote: Total RNA from pools of 5 to 8 mosquitoes was isolated with TRIzol (Invitrogen). Small RNAs of 19-33 nucleotides in length were purified from a 15% acrylamide/bisacrylamide (37.5:1) ...
-
bioRxiv - Immunology 2022Quote: ... and 2 mg/ml collagenase 8 (Gibco) for 45 min at 37 °C ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2020Quote: Dried fractions were resuspended in 8 μL 5% ACN + 5% FA and analyzed on an Orbitrap Fusion with in-line Easy Nano-LC 1000 (Thermo Scientific). Fractions were run as 3 h gradients progressing from 3% ACN + 0.125% FA to 100% ACN + 0.125% FA ...
-
bioRxiv - Cell Biology 2022Quote: Dictyostelium discoideum cells were maintained in Hans’ enriched HL-5 media (1.4X HL-5 media with 8% FM, penicillin and streptomycin) at 22°C in petri dishes (Fisher Scientific; FB0875712). A full list of strains used in this study can be found in Appendix Table S3.
-
bioRxiv - Neuroscience 2021Quote: ... into jaw closer muscles of 5-8 day old mouse pups with 1-2% dilution of Alexa Fluor 488 hydrazide (Life Technologies), under isoflurane anesthesia.
-
bioRxiv - Cell Biology 2020Quote: ... Human IL-6 and IL-8 ELISAs were from Thermofisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... 6-8 μL Lipofectamine-LTX (15338100, Thermo Fisher Scientific, USA) was added to the plasmid solution which was then mixed and incubated at room temperature for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Human iPSC lines were maintained in 5% CO2 environment in Essential 8 Medium (Thermo Fisher). For cardiomyocyte differentiation ...
-
bioRxiv - Cell Biology 2019Quote: ... for 5 min and separated on a 3-8% tris-acetate gel (ThermoFisher Scientific; EA0375BOX). Following electrophoresis ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 5% FBS or at P7-8 in ice-cold Hibernate-A Medium (ThermoFisher, A1247501) with 10% FBS and B-27 Supplement (ThermoFisher ...
-
bioRxiv - Biophysics 2023Quote: Cells were seeded onto 5 µg/ml laminin (BioLamina LN511) coated 8-chamber coverglass (Nunc™ Lab-Tek™ II Chambered Coverglass ...
-
bioRxiv - Genomics 2024Quote: ... solution (1mg L-Cystine, Sigma; 8 KU of DNase I, Affymetrix; in 5 ml DPBS), retina was incubated at 37C for ∼20min ...
-
bioRxiv - Cell Biology 2022Quote: ... For treatment of embryos with 1,6-hexanediol (HXD, Acros Organics cat # 629-11-8), L4 larvae were fed with ptr-2 RNAi for 18-24 hr at 20°C ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Microbiology 2022Quote: 8-Hydroxyquinoline-2-carboxylic acid (98%, ACROS Organics) was dissolved in distilled water with pH adjusted to 10 using a solution of 1 M sodium hydroxide for better solubility ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...