Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Cyclohexylcarbamoylcyclohex 3 enecarboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Microbiology 2023Quote: ... Substrate 2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS; Thermo Fisher Scientific) was added ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-[p-(6-phenyl)-1,3,5-hexatrienyl] phenylpropionic acid was purchased from Molecular Probes (Eugene, OR, USA) and 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphocholine (SLPC ...
-
bioRxiv - Immunology 2020Quote: ... plates were incubated with 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) substrate (ABTS, Thermo Fisher Scientific) for 15 min at RT shielded from light and absorbance was measured at optical density (OD ...
-
bioRxiv - Physiology 2023Quote: ... with or without 0.1uM 6-Hydroxyhexanoic acid (6-HHA, ThermoFisher, B24857.03).
-
bioRxiv - Molecular Biology 2020Quote: ... flushed with argon prior to adding hydrochloric acid (3 mL of 6 M sequencing grade solution; Thermo Scientific #PI24308). Sealed tubes were kept at 125° C for 48h (oil bath ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Genomics 2020Quote: ... and 3 mL acid phenol:chloroform (Thermo Fisher). This mixture was heated to 65°C and shaken at 1400 rpm for 10 minutes followed by 5 minutes on ice ...
-
bioRxiv - Immunology 2022Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...
-
bioRxiv - Immunology 2023Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 mL non essential amino acids (Gibco, Life Technologies), 6 mL 200 mM L-glutamine (Gibco ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 mL non essential amino acids (Gibco, Life Technologies), 6 mL 200 mM L-glutamine (Gibco ...
-
bioRxiv - Immunology 2022Quote: ... and the wells were washed five times with wash buffer before the addition of 2,2’-azino-bis (3-ethylbenzothiazoline-6-sulphonic acid (ABTS, #37615, Thermo Fisher Scientific). Optical density was read 40 min later at 405 nm using a plate reader (SpectraMax i3 ...
-
Chemoproteomics of microbiota metabolites reveals small-molecule agonists for orphan receptor GPRC5AbioRxiv - Biochemistry 2021Quote: ... indole-3-acetatic acid (Fisher Scientific, Catalog #11453194), tryptamine (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μM Hoechst 33342 nucleic acid stain (Thermo Fisher Scientific) was added to each well at least 1 hour before images were taken ...
-
bioRxiv - Microbiology 2019Quote: ... and 3-6 μl Lipofectamin 2000 (Life Technologies). See the Supplemental Information for detailed description.
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... sections were rinsed in 3% acetic acid (Fisher Scientific) for 3 minutes and incubated at room temperature for 30 minutes in 1% Alcian Blue 8GX (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2021Quote: ... and 3-mercaptopropionic acid were purchased from ACROS ORGANICS. Hydrogen tetrachloroaurate(III ...
-
bioRxiv - Developmental Biology 2023Quote: ... acidified to pH2-3 by trifluoroacetic acid (Thermofisher, 85183), and desalted with a Pierce C18 spin column (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... DiIC18(3) dye (6 mg; Invitrogen, Carlsbad, CA, USA) was dissolved in 99.5% methylene chloride (300 μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Pathology 2020Quote: ... citric acid (Fisher Scientific, Cat. No. A104-3, Hampton, NH), sodium phosphate (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 sodium pyruvate and 0.40 L-ascorbic acid (Acros Organics), bubbled to a pH of 7.4 with 5% CO2 in 95% O2 ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 sodium pyruvate and 0.40 L-ascorbic acid (Acros Organics), bubbled with 5% CO2 in 95% O2 ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 sodium pyruvate and 0.40 L-ascorbic acid (Acros Organics), bubbled with 5% CO2 in 95% O2 ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the samples were reconstituted in 6 uL 0.1% formic acid (FA) 0.05% heptafluorobutyric acid (HFBA) (Thermo Fisher Scientific, cat. 25003).
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: ... and passaged every 4-6 days with 0.5mM ethylenediaminetetraacetic acid (EDTA, Invitrogen 15575020) in Dulbecco’s Phosphate-Buffered Saline (DPBS ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... 3 µl of Dynabeads MyOne Carboxylic Acid (1 μm; ThermoFisher Scientific) were added at a concentration of 0.5 mg/ml to each of the samples ...
-
bioRxiv - Molecular Biology 2022Quote: ... Indole-3-acetic acid (IAA) was purchased from ThermoFisher (Product #I3750). IAA treatment was performed as previously described (Zhang et al ...
-
bioRxiv - Biophysics 2023Quote: ... 3-(N-morpholino)propanesulfonic acid) (MOPS) was purchased from Acros Organics. Texas Red DHPE (TR-DHPE) ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Neuroscience 2021Quote: ... neurons were anchored with succinimidyl ester of 6-((Acryloyl)amino) hexanoic acid (AcX) (Thermofisher) in PBS (0.1mg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... SE (6-((acryloyl)amino)hexanoic acid)-labelled fibronectin (A20770, ThermoFisher Scientific; FC010, EMD Millipore), and polymerized on activated glass coverslips for 1 hr at room temperature ...
-
bioRxiv - Physiology 2020Quote: Acid extracted rat tail Type I Collagen (3 mg/mL; Thermo Fisher) was maintained at 4°C until polymerization ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... for 3 min and incubated in 1% phosphomolybdic acid then acetic acid solution (A38C-212; Thermo Fisher Scientific, Waltham, MA) for 5 min and 3 min ...
-
bioRxiv - Microbiology 2021Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng/ml IL-6 and 10 ng/ml IL-3 (Gibco). Inpp4b+/+ and Inpp4b-/- LSK were each retrovirally transduced with pMSCV-MLL-AF9-IRES-mVenus ...
-
bioRxiv - Microbiology 2023Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Genetics 2023Quote: 3 independent total RNA extractions from 30 ovaries from 3-6-day-old RevI-H2i2 flies using Trizol (Invitrogen) were performed ...