Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Chloropyrazolo 1 5 a pyridine 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... 5-norbornene-2-carboxylic acid (99%, Fisher Scientific) (12:1 to HA-TBA repeat unit) ...
-
bioRxiv - Microbiology 2022Quote: 8-Hydroxyquinoline-2-carboxylic acid (98%, ACROS Organics) was dissolved in distilled water with pH adjusted to 10 using a solution of 1 M sodium hydroxide for better solubility ...
-
bioRxiv - Synthetic Biology 2023Quote: ... DynaBead MyOne carboxylic acid (Invitrogen), 1M MgCl2 (Invitrogen) ...
-
bioRxiv - Neuroscience 2019Quote: ... Alexa 405 carboxylic acid (Invitrogen, #A30000) and Cy3 mono-reactive dye pack (GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... of Dynabeads M-270 Carboxylic acid (Invitrogen) by using a two-step coating procedure with EDC and NHS as indicated by the manufacturer ...
-
bioRxiv - Neuroscience 2019Quote: ... Alexa Fluor 647 carboxylic acid (Invitrogen, #A20006). The extent of co-localization of STIM1 and JPH4 was determined with the same primary antibodies as in PLA experiments (Table S1) ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μm Dynabeads (Dynabeads MyOne Carboxylic acid #65011, Thermo Fisher Scientific) were added to the cells at a dilution of 1:20 ...
-
bioRxiv - Immunology 2022Quote: ... 3 µl of Dynabeads MyOne Carboxylic Acid (1 μm; ThermoFisher Scientific) were added at a concentration of 0.5 mg/ml to each of the samples ...
-
bioRxiv - Biophysics 2024Quote: Quantitative determination of intracellular pH (pHi) was performed using the cell-permeant ratiometric pH indicator SNARF™-5F 5-(and-6)-carboxylic acid AM (Thermo Fisher) in live imaged N2a cells at 48 hours of differentiation ...
-
bioRxiv - Developmental Biology 2020Quote: ... was captured using a GFP binding protein (GBP) covalently conjugated to carboxylic acid decorated Dynabeads (Dynabeads M-270 carboxylic acid, Thermo Fisher Scientific). Untagged SMO (Fig ...
-
bioRxiv - Immunology 2020Quote: ... and Alexa Fluor 647 Carboxylic Acid succinimidyl Ester (Invitrogen). Antibody labelling reactions were performed by incubating a mixture of secondary antibody ...
-
bioRxiv - Neuroscience 2022Quote: ... Dynabeads M-270 carboxylic acid (14305D, Thermo Fisher Scientific) were then added (2 µg/µl final concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... and Alexa Fluor 647 Carboxylic Acid succinimidyl Ester (Invitrogen). Antibody labelling reactions were performed as previously reported (Borgman et al. ...
-
bioRxiv - Bioengineering 2021Quote: ... Dynabeads M-270 Carboxylic Acid were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Biophysics 2022Quote: ... Alexa546 and Alexa647 carboxylic acid were obtained from Thermo Fisher. PEG 4000 and 6000 were from Sigma Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.01mg/ml Alexa Fluor 594 carboxylic acid (Thermo Fisher, A33082) was dissolved in the patch pipette solution ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Biophysics 2023Quote: ... Carboxylated 1 μm paramagnetic beads were obtained from Thermo Fischer (Dynabeads MyOne Carboxylic Acid, ThermoFisher, USA). 5 μl of the bead solution were centrifuged ...
-
bioRxiv - Biophysics 2020Quote: ... an aliquot of 100 μL carboxylic acid paramagnetic Dynabeads M-270 (Invitrogen) and 10 μL of 5 mg∙mL−1 of protein A (Sigma-Aldrich) ...
-
bioRxiv - Biophysics 2023Quote: Alexa 488 carboxylic acid was obtained as lyophilized powder from Thermo Fisher. Stock solutions at millimolar concentrations were prepared in dimethyl sulfoxide and further diluted in PBS buffer ...
-
bioRxiv - Bioengineering 2023Quote: ... Linear mRNA was purified using Dynabeads MyOne Carboxylic Acid beads (Thermo Fisher).
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Physiology 2023Quote: The dried polar extracts were prepared for GC-MS analysis through solubilization in 40 µL of 2% methoxyamine hydrochloric acid in pyridine (Fisher Scientific) at 60°C for 60 min and derivatization with 60 µL of N-tertbutyldimethylsilyl-N-methyltrifluoroacetamide (MTBSTFA ...
-
bioRxiv - Biophysics 2020Quote: ... consisting of 22 μM NSP5 supplemented with 6.4 μM Alexa647 dye (carboxylic acid, ThermoFisher) or 8 μM His-tagged NSP2 labelled with 8 μM Atto488-nitrilotriacetic acid (NTA ...
-
bioRxiv - Systems Biology 2021Quote: ... and Dynabeads MyOne Carboxylic acid were obtained from Thermo Scientific (San Jose, CA, USA). FG beads COOH and FG beads NH2 were from TAMAGAWA SEIKI (Nagano ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were cleaned up using CA-magnetic beads (Dynabeads® MyOne Carboxylic Acid, Invitrogen), and 17% PEG 6000 (Sigma-Aldrich © LLC) ...
-
bioRxiv - Immunology 2023Quote: ... were randomly conjugated with Alexa Fluor 647 carboxylic acid succinimidyl ester (Thermo Fisher Scientific) and EZ-Link™ NHS-LC-LC-Biotin in a 1 to 2 molar ratio (protein:dye and protein:biotin ...
-
bioRxiv - Biophysics 2023Quote: ... Monomeric (G)-actin was fluorescently labeled with AlexaFluor 488 carboxylic acid succimidyl ester (Invitrogen) (62) ...
-
bioRxiv - Neuroscience 2019Quote: ... Cells were passaged 1:2-1:6 every 2-5 days by being rinsed once with DPBS (Gibco) and dissociated using 0.5 mM EDTA (75 μl/cm2 ...
-
bioRxiv - Cancer Biology 2023Quote: Cyclic RGD conjugated MPIO were prepared using 1 μm diameter Dynabead MyOne carboxylic acid MPIO (65011, Fisher Scientific, UK). MPIO were washed in MES buffer and resuspended ...
-
bioRxiv - Systems Biology 2019Quote: ... in pyridine (Acros Organics) and then by N-methyl-N-(trimethylsilyl ...
-
bioRxiv - Cell Biology 2019Quote: ... By adding a tracer dye (0.5 μg/mL Alexa Fluor 647 carboxylic acid; Life Technologies) to the sorbitol-supplemented medium ...
-
bioRxiv - Immunology 2021Quote: ... human cGAS was labelled with AlexaFluor-488 (AF488) carboxylic acid (succinimidyl ester) (Thermo Fisher Scientific) according to manufacturer’s manuals using a molar ratio of 1:10 at 4°C for 4 h ...
-
bioRxiv - Bioengineering 2020Quote: ... Alexa Fluor 555 carboxylic acid succinimidyl ester was obtained from Life Technologies (Carlsbad, CA, USA). Protein samples were labeled with Alexa Fluor 555 carboxylic acid succinimidyl ester according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: ... PAO1 was fluorescently stained using Alexa Fluor carboxylic acid succinimidyl esters (Alexa Fluor 488, ThermoFisher) as described previously (Friedlander et al ...
-
bioRxiv - Molecular Biology 2020Quote: ... Dynabeads MyOne™ Carboxylic Acid and 100mM of each dNTP were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2,4-Pyridine Dicarboxylic Acid (2,4-PCA) is purchased from Acros Organics (New Jersey, Catalog number 101860010). JIB-04 is purchased from Sigma-Aldrich (St ...
-
bioRxiv - Neuroscience 2020Quote: ... was added to 1 mg (1.25 μmol, MW ~ 800) of the Alexa-Fluor®-647 carboxylic acid succinimidyl ester (Invitrogen/ThermoFisher Scientific). The reaction mixture was stirred for 5 h at room temperature in the dark ...
-
bioRxiv - Cell Biology 2021Quote: ... Wnt3a proteins were immobilized to 2.8 μm carboxylic acid–coated Dynabeads® (cat. num. 14305D, ThermoFisher), as described before (Habib et al. ...
-
bioRxiv - Biophysics 2022Quote: ... and PEG 20k (15% w/v) supplemented with 3 μM Alexa 546 dye (carboxylic acid, ThermoFisher). The protein solution consisted of 70 μM HMGA1a supplemented with 10 μM Alexa647-labelled HMGA1a ...
-
bioRxiv - Immunology 2020Quote: ... The dyes were purchased as NHS ester derivatives: Alexa Fluor 405 Carboxylic Acid Succinimidyl Ester (Invitrogen), Cy3 mono-Reactive Dye Pack (GE HealthCare) ...
-
bioRxiv - Genomics 2021Quote: ... Size-selection and cleanup were accomplished using CA-magnetic beads (Dynabeads® MyOne Carboxylic Acid, Invitrogen), and 11-11.5% PEG 6000 (Sigma-Aldrich © LLC) ...
-
bioRxiv - Bioengineering 2024Quote: ... Concentration of C2 to C6 carboxylic acids and alcohols were analyzed by gas chromatography (Thermofisher, USA) using a Stabil-wax™ column with a length of 25 m and internal diameter of 0.2 μm ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2020Quote: ... was added to 1 mg (1.25 μmol, MW ~ 800) of the Alexa-Fluor®-647 carboxylic acid succinimidyl ester (Invitrogen/ThermoFisher Scientific). The reaction mixture was stirred for 5 h at room temperature in the dark ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 - diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Bioengineering 2021Quote: Protein supernatants were then labelled with Alexa Fluor® 555 carboxylic acid succinimidyl ester (AF555) (ThermoFisher Scientific) essentially as previously described [76] ...
-
bioRxiv - Biophysics 2022Quote: ... Fluorescent G-actin was prepared by labelling G-actin with AlexaFluor 488 carboxylic acid succimidyl ester (Invitrogen, through Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... The dyes used for labelling were NHS ester derivatives: Alexa Fluor 405 Carboxylic Acid Succinimidyl Ester (Invitrogen), Cy3 mono-Reactive Dye Pack (GE HealthCare) ...
-
bioRxiv - Biochemistry 2024Quote: hSSB1 and INTS3 proteins were labeled with AF647 (Alexa Fluor 647 carboxylic acid succinimidyl ester, Thermo Fisher). Proteins were dialyzed against Labeling buffer (50 mM MES pH 6.5 ...