Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Chloro 7H pyrrolo 2 3 d pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...
-
bioRxiv - Microbiology 2024Quote: ... containing 100 mg/ml of X-gal (5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Thermofisher) to confirm CFU/ml counts.
-
bioRxiv - Synthetic Biology 2024Quote: ... 100 μM isopropyl-β-D-thiogalactopyranoside (IPTG) and 100 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galacto-pyranoside (X-gal) (Thermo Fisher Scientific). After incubation overnight at 37 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... or X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside, W5376C; Thermo Fisher Scientific, Guilford, CT). GUS and/or LacZ-stained tissues were cleared for 30 s with 12 % sodium hypochlorite solution before microscopy observations.
-
bioRxiv - Biochemistry 2022Quote: ... The quality of obtained microsomes was tested with 9-amino-6-chloro-2-methoxyacridine (ACMA; Invitrogen A1324) fluorescence quenching assays.
-
bioRxiv - Neuroscience 2021Quote: ... a staining solution of 1 mg/mL 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal, Invitrogen), 1× citratesodium phosphate buffer (pH 6.0) ...
-
bioRxiv - Microbiology 2023Quote: ... was used for induction of gene expression and X-gal (X-Gal 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside; Thermofisher) TSA plates were used for bacterial assessment ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM 2-deoxy-D-glucose (2DG; ACROS Organics), 2 μM PERK inhibitor (PERKi ...
-
Turanose induced WOX5 restores symbiosis in the Medicago truncatula cytokinin perception mutant cre1bioRxiv - Plant Biology 2020Quote: ... and immersed and incubated in the dark in staining solution 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronicacid (X-Gluc, Thermo Scientific), 50mM sodium phosphate buffer ...
-
bioRxiv - Plant Biology 2019Quote: To assess GUS expression driven by the maize ubiquitin promoter in transgenic barley transformed with the pBRACT214m-GUS construct we collected different tissues and stained these with 1mg/ml of X-gluc (5-bromo-4-chloro-3-indolyl-B-D-glucuronic acid, Thermo Scientific, USA) in X-gluc buffer (100mM sodium phosphate buffer pH 7.0 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7H11 plates contained 50 μg/mL hygromycin and 50 μM 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) (Thermo Scientific). Unless specified ...
-
bioRxiv - Microbiology 2020Quote: ... 10 ml l1 glycerol and 20 g l−1 Bacto agar) supplemented with 25 µg ml−1 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal, Thermo Fisher Scientific). Overnight cultures of the control strains were normalized to OD600 = 1.0 and inoculated as 20 µl spots on the agar plates containing the biosensor ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cultures were plated on LB agar plates containing 60 μg/mL 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal; Thermo Fisher Scientific catalogue no. R0402). Antibiotics in media for bacterial growth were used at the following working concentrations ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Synthetic Biology 2020Quote: ... cells from 2-D or 3-D cultures were harvested from one well of a 6-well plate and dissociated with Accutase (Thermo Fisher #A1110501), washed three times with 1x PBS ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Life Technologies D-21490, 1:2000) for 15 min ...
-
bioRxiv - Bioengineering 2020Quote: Before staining with either 5-bromo-4-chloro-3’-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, ThermoFisher) or Alizarin Red S (ARS ...
-
bioRxiv - Physiology 2024Quote: ... / bromo-chloro-indolyl phosphate (Thermo Scientific) in AP buffer or using Naphtol AS-MX phosphate and Fast Red (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Cell Biology 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (cat#D-1306) and TRIzolTM (cat#15596018) were purchased from ThermoFisher Scientific (Waltham ...
-
bioRxiv - Immunology 2023Quote: ... 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (Thermo Fisher Scientific, cat.: 34042) was added and the reaction was terminated after 5 min under running tap water ...
-
bioRxiv - Neuroscience 2021Quote: ... Nucleus staining was performed using 4’,6-diamidino-2-phenylindole (DAPI) (3 mM, D3571, Molecular Probes). Cells were counted from four randomly selected fields per culture under a confocal microscope (TCS SP8 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Physiology 2021Quote: 2-3 viable human slices were incubated with Fluo4-AM (6 μM, Invitrogen cat. No. F1221) for 1h in 3 mM HEPES buffer (125 mmol/l NaCl ...
-
bioRxiv - Cell Biology 2020Quote: Total cellular mRNA was isolated from cells grown in 2-D and 3-D culture conditions using the GeneJET RNA purification kit (Thermo Fisher Scientific). For analysis of germ layer markers ...
-
bioRxiv - Immunology 2020Quote: ... D-PBS (D-PBS without Ca++ and Mg++) supplemented with 2% FBS and 3 mM cell culture grade EDTA (Life Technologies; Thermofisher) prior to monocyte isolation ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Cell Biology 2021Quote: ... 6′-diamidino-2-phenylindole (Invitrogen). All observations were performed on a Nikon E600 epifluorescence microscope ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 cells (Shanbhag et al., 2010) were cultured in McCoy’s 5A (Modified) Medium (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... DAPI (4’,6-Diamidino-2-henylindole, dihydrochloride) was obtained from Invitrogen (Catalog: D1306, CAS:28718-90-3).
-
bioRxiv - Neuroscience 2019Quote: ... DiI C18(3) (D-282; Molecular Probes) was injected into coronal slices of E13 hemispheres (Figures 4C and 4D) ...
-
bioRxiv - Microbiology 2020Quote: ... 2% D-glucose (Fisher Scientific), 1% yeast extract (BD Bacto)) ...
-
bioRxiv - Microbiology 2022Quote: ... or in 2 ml liquid MSgg with 7-d-old tomato seedlings in a 6-well plate (Thermo Scientific). Each well contained one seedling ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixture was resuspended in 1 ml of DMEM before adding the mixture to a 6-well plate containing 2 ml of DMEM with 4.5 g/L D-Glucose and L-Glutamine (Gibco) supplemented with supplemented 10% FBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Cancer Biology 2020Quote: ... TIC-enriching 3-D cultures (3-D) were maintained in stem cell media: DMEM:F12 (+ L-glutamine, + 15 mM HEPES) (Gibco) supplemented with 1% penicillin/streptomycin ...
-
bioRxiv - Neuroscience 2022Quote: ... the cerebral cortexes from 2-3 P3-P5 C57BL/6 mice were collected in ice cold HBSS (Invitrogen), the tissue was washed three times with HBSS and digested with 0.04% trypsin (Sigma ...