Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Chloro 1 2 dihydro 3H indazol 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Physiology 2019Quote: ... and HDMBOA (4,7-dimethoxy-2-{[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy}-3,4-dihydro-2H-1,4-benzoxazin-3-one)) (Block et al., 2019) (Yang et al., 2019) were quantified using HPLC (Thermofisher scientific) which was coupled with MS (UltiMate 3000 HPLC ...
-
bioRxiv - Cell Biology 2023Quote: ... For nuclear staining 0.5µg/µL of DAPI (4’, 6-diamidino-2-phenylindole, dihydro-chloride, Invitrogen. Cat. No.: D3571) was added along with secondary antibody ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Biochemistry 2022Quote: ... The quality of obtained microsomes was tested with 9-amino-6-chloro-2-methoxyacridine (ACMA; Invitrogen A1324) fluorescence quenching assays.
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Microbiology 2024Quote: ... Plates were washed five times with PBS and then twice with distilled water (dH2O) before addition of 5-bromo-4-chloro-3-indolyl-phosphate/NBT (BCIP/NBT) one-step solution (Thermo Fisher Scientific) and incubation at 37°C for approximately 15 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... Then one drop of DAPI (4′, 6-diamidino-2-phenylindole, ThermoFisher Scientific) was added to the suspension and 25 nuclei were sorted by Aria II (BD ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... potential was examined using 5,6-dichloro-2-[3-(5,6-dichloro-1,3-diethyl-1,3-dihydro-2H-benzimidazol-2-ylidene)-1propenyl]-1,3-diethyl-,iodide (JC-1 dye) (Life Technologies, USA) as a probe ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Cell Biology 2022Quote: ... dihydro-chloride (DAPI) (Invitrogen. Cat. Nº: D3571) at 0.5 µg/µl ...
-
bioRxiv - Microbiology 2022Quote: The PfHDAC1-2xFKBP-GFP knockin NF54 line parasitized RBCs (mock or 100 nM dihydro artemisinin treated from ∼21-24 HPI/3 hours) were crosslinked using 1% formaldehyde (Thermo Scientific, 28908) for 10 mins at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Neuroscience 2021Quote: ... a staining solution of 1 mg/mL 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal, Invitrogen), 1× citratesodium phosphate buffer (pH 6.0) ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Pathology 2020Quote: ... 6-dihydroxy-2,4,5,7-tetraio-dospiro (isobenzofuran-1(3H),9[9H] xanthan)-3:1 dipotassium salt (50 mg/kg in 0.9% saline, Fisher Scientific) was injected retro-orbitally before catalyzing vessel injury with a 540 nm laser ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Microbiology 2020Quote: ... 10 ml l1 glycerol and 20 g l−1 Bacto agar) supplemented with 25 µg ml−1 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal, Thermo Fisher Scientific). Overnight cultures of the control strains were normalized to OD600 = 1.0 and inoculated as 20 µl spots on the agar plates containing the biosensor ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with FluorSave (Calbiochem).
-
bioRxiv - Cell Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with a FluorSaveTM reagent (Merck-Millipore).
-
bioRxiv - Cancer Biology 2023Quote: ... anti-CD11a (1:50, IBL-6/2, Invitrogen), and FITC anti-PD-1 (1:50 ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Cell Biology 2020Quote: ... then stained for one minute with 30 ng/mL 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, D1306) in 1x PHEM ...
-
bioRxiv - Cell Biology 2021Quote: ... then stained for one minute with 30 ng/mL 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen D1306) in 1x PHEM ...
-
Turanose induced WOX5 restores symbiosis in the Medicago truncatula cytokinin perception mutant cre1bioRxiv - Plant Biology 2020Quote: ... and immersed and incubated in the dark in staining solution 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronicacid (X-Gluc, Thermo Scientific), 50mM sodium phosphate buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Cell Biology 2019Quote: ... Slides were washed 3 × 10 min with PBS and nuclei stained with 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) in PBS for 15 min ...
-
bioRxiv - Biochemistry 2021Quote: ... 1-O-(6-BODIPY®558/568-aminohexyl)-2-BODIPY®FL C5-sn-glycero-3-phosphocholine (Thermo Fisher Scientific) as described previously [38] ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 ng/mL TPO and 40 ng/mL IL-3 from day 1 to day 6 with a media refresh every 2 days (all cytokines from Thermofisher). On day 8 ...
-
bioRxiv - Physiology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:25000, Thermo Fisher) diluted in PBS and mounted with Prolong Gold Antifade Medium (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-Diamadino-2-phenylindole (DAPI, 1:1000, Invitrogen) was incubated after secondary antibody incubation for 15 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:1000), Mouse antiglial fibrillary acidic protein (GFAP ...
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...
-
bioRxiv - Bioengineering 2020Quote: Before staining with either 5-bromo-4-chloro-3’-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, ThermoFisher) or Alizarin Red S (ARS ...
-
bioRxiv - Microbiology 2024Quote: ... containing 100 mg/ml of X-gal (5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Thermofisher) to confirm CFU/ml counts.
-
bioRxiv - Biochemistry 2023Quote: The panel of synthetic peptide standards and the products of immunoprecipitated heparan-sulfate 6-O-sulfotransferase 1/2/3 (H6ST-1/2/3) in vitro Tyr sulfation assays were analyzed using Proteome Discoverer 2.4 (Thermo Scientific) in conjunction with MASCOT 59 against either a custom database of all (12 ...
-
bioRxiv - Physiology 2024Quote: ... / bromo-chloro-indolyl phosphate (Thermo Scientific) in AP buffer or using Naphtol AS-MX phosphate and Fast Red (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Cancer Biology 2020Quote: ... One ng/mL recombinant human interleukin (IL)-6 (Gibco, Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Total DNA was stained using 4’,6-diamidino-2- phenylindole (DAPI) diluted 1:10000 in PBS containing 3% BSA (Molecular Probes) to illuminate host cell nuclei ...
-
bioRxiv - Genomics 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Life Technologies) was added to visualize cell nuclei ...