Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 CHLORO 2 METHYLIMIDAZO 1 2 A PYRIDINE 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... 5-norbornene-2-carboxylic acid (99%, Fisher Scientific) (12:1 to HA-TBA repeat unit) ...
-
bioRxiv - Microbiology 2022Quote: 8-Hydroxyquinoline-2-carboxylic acid (98%, ACROS Organics) was dissolved in distilled water with pH adjusted to 10 using a solution of 1 M sodium hydroxide for better solubility ...
-
bioRxiv - Immunology 2022Quote: ... 3 µl of Dynabeads MyOne Carboxylic Acid (1 μm; ThermoFisher Scientific) were added at a concentration of 0.5 mg/ml to each of the samples ...
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... DynaBead MyOne carboxylic acid (Invitrogen), 1M MgCl2 (Invitrogen) ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Neuroscience 2019Quote: ... Alexa 405 carboxylic acid (Invitrogen, #A30000) and Cy3 mono-reactive dye pack (GE Healthcare ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Biochemistry 2022Quote: ... The quality of obtained microsomes was tested with 9-amino-6-chloro-2-methoxyacridine (ACMA; Invitrogen A1324) fluorescence quenching assays.
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2021Quote: ... of Dynabeads M-270 Carboxylic acid (Invitrogen) by using a two-step coating procedure with EDC and NHS as indicated by the manufacturer ...
-
bioRxiv - Neuroscience 2019Quote: ... Alexa Fluor 647 carboxylic acid (Invitrogen, #A20006). The extent of co-localization of STIM1 and JPH4 was determined with the same primary antibodies as in PLA experiments (Table S1) ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μm Dynabeads (Dynabeads MyOne Carboxylic acid #65011, Thermo Fisher Scientific) were added to the cells at a dilution of 1:20 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Microbiology 2024Quote: ... 1% N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid (HEPES, Gibco, #15630080) and 1% MEM nonessential amino acids (MEM-NEAA ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Physiology 2023Quote: The dried polar extracts were prepared for GC-MS analysis through solubilization in 40 µL of 2% methoxyamine hydrochloric acid in pyridine (Fisher Scientific) at 60°C for 60 min and derivatization with 60 µL of N-tertbutyldimethylsilyl-N-methyltrifluoroacetamide (MTBSTFA ...
-
bioRxiv - Biophysics 2022Quote: ... and PEG 20k (15% w/v) supplemented with 3 μM Alexa 546 dye (carboxylic acid, ThermoFisher). The protein solution consisted of 70 μM HMGA1a supplemented with 10 μM Alexa647-labelled HMGA1a ...
-
bioRxiv - Immunology 2021Quote: ... and 1% HEPES (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid; Gibco). Wild type SARS-CoV-2 (isolate USA-WA1/2020) ...
-
bioRxiv - Microbiology 2022Quote: ... and 1% HEPES (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid; Gibco). Wild type SARS-CoV-2 (isolate USA-WA1/2020 ...
-
bioRxiv - Developmental Biology 2020Quote: ... was captured using a GFP binding protein (GBP) covalently conjugated to carboxylic acid decorated Dynabeads (Dynabeads M-270 carboxylic acid, Thermo Fisher Scientific). Untagged SMO (Fig ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Immunology 2020Quote: ... and Alexa Fluor 647 Carboxylic Acid succinimidyl Ester (Invitrogen). Antibody labelling reactions were performed by incubating a mixture of secondary antibody ...
-
bioRxiv - Neuroscience 2022Quote: ... Dynabeads M-270 carboxylic acid (14305D, Thermo Fisher Scientific) were then added (2 µg/µl final concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... and Alexa Fluor 647 Carboxylic Acid succinimidyl Ester (Invitrogen). Antibody labelling reactions were performed as previously reported (Borgman et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Immunology 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Invitrogen) and 2-mercaptoethanol (Gibco) ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with FluorSave (Calbiochem).
-
bioRxiv - Cell Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with a FluorSaveTM reagent (Merck-Millipore).
-
bioRxiv - Cancer Biology 2023Quote: ... anti-CD11a (1:50, IBL-6/2, Invitrogen), and FITC anti-PD-1 (1:50 ...
-
bioRxiv - Bioengineering 2021Quote: ... Dynabeads M-270 Carboxylic Acid were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Biophysics 2022Quote: ... Alexa546 and Alexa647 carboxylic acid were obtained from Thermo Fisher. PEG 4000 and 6000 were from Sigma Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.01mg/ml Alexa Fluor 594 carboxylic acid (Thermo Fisher, A33082) was dissolved in the patch pipette solution ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then treated with hexamethyldisilazane-trimethylchlorosilane-pyridine solution (3:1:9; ThermoFisher) for 20 min at 110°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), 1% Penicillin/Streptomycin/L-Glutamate (P/S/G ...
-
bioRxiv - Physiology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:25000, Thermo Fisher) diluted in PBS and mounted with Prolong Gold Antifade Medium (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-Diamadino-2-phenylindole (DAPI, 1:1000, Invitrogen) was incubated after secondary antibody incubation for 15 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:1000), Mouse antiglial fibrillary acidic protein (GFAP ...
-
bioRxiv - Biochemistry 2023Quote: The panel of synthetic peptide standards and the products of immunoprecipitated heparan-sulfate 6-O-sulfotransferase 1/2/3 (H6ST-1/2/3) in vitro Tyr sulfation assays were analyzed using Proteome Discoverer 2.4 (Thermo Scientific) in conjunction with MASCOT 59 against either a custom database of all (12 ...
-
bioRxiv - Biochemistry 2019Quote: ... fluorescent probes Prodan (6-propionyl-2[dimethylamino]-naphthalene) and ANS (1-anilinonaphthalene-8-sulfonic acid) were also from Invitrogen; PMB ...
-
bioRxiv - Cell Biology 2021Quote: ... 6′-diamidino-2-phenylindole (Invitrogen). All observations were performed on a Nikon E600 epifluorescence microscope ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Cell Biology 2023Quote: ... N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid (HEPES) (Gibco), Sodium Pyruvate (Gibco) ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...