Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Boc 1 oxa 6 azaspiro 3.3 heptan 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37 °C ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2023Quote: ... HSPCs were incubated with 20µM NBD C6-Ceramide (6-((N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)amino)hexanoyl)Sphingosine) (Invitrogen) for 30 minutes at 4°C for Golgi staining or Cytopainter (Abcam ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Immunology 2021Quote: ... mouse interleukin 6 (IL-6; ThermoFisher; 1:500). Sections were then stained for DAPI (Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Cancer Biology 2020Quote: ... One ng/mL recombinant human interleukin (IL)-6 (Gibco, Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... and 3-6 μl Lipofectamin 2000 (Life Technologies). See the Supplemental Information for detailed description.
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and optiMEM (1:6; Gibco) or were left untreated ...
-
bioRxiv - Neuroscience 2021Quote: ... DiIC18(3) dye (6 mg; Invitrogen, Carlsbad, CA, USA) was dissolved in 99.5% methylene chloride (300 μL ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2022Quote: ... Then one drop of DAPI (4′, 6-diamidino-2-phenylindole, ThermoFisher Scientific) was added to the suspension and 25 nuclei were sorted by Aria II (BD ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Slices were finally incubated for 3-6 minutes with DAPI (1:10 000, Invitrogen) diluted in PBS and mounted on Polysine® Slides stored at 4°C until imaging.
-
bioRxiv - Physiology 2020Quote: ... interleukin 6 (IL-6; Invitrogen, Carlsbad, CA), plasminogen activator inhibitor 1 (PAI-1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 wells of a 6-well plate of mESC (corresponding to 6*10^6 cells approximately) were resuspended in 1 mL Trizol (Invitrogen,15596018) vortexed two times for 30 seconds and incubated 5 minutes at room temperature ...
-
bioRxiv - Bioengineering 2019Quote: VRCs or HT29 cells cultured for one day on 6 well plate (Nunc) were washed with HBSS - Hank’s Balanced Salt Solution (Thermo ...
-
bioRxiv - Synthetic Biology 2020Quote: ... cells from 2-D or 3-D cultures were harvested from one well of a 6-well plate and dissociated with Accutase (Thermo Fisher #A1110501), washed three times with 1x PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... 1ml of bone marrow was incubated in one well of 6-well plate with 3 ml StemPro™ MSC serum-free medium (Gibco, Thermo Scientific). Media was changed after every two days until it reached to confluency ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Cell Biology 2021Quote: ... 1ml of bone marrow was incubated in one well of 6-well plate with 3 ml StemPro™ MSC serum-free medium (Gibco, Thermo Scientific). Media was changed after every two days until it reached to confluency ...
-
bioRxiv - Neuroscience 2022Quote: One-step quantitative real-time PCR was performed in a QuantStudio 6 (Thermo Fisher) using GoTaq® Probe 1-Step RT-qPCR System (Promega) ...
-
bioRxiv - Developmental Biology 2022Quote: ... bTSCs were passaged every 6 days at a 1:6 split ratio using Accutase (Gibco, A1110501). Each well of bTSCs was dissociated by 1 mL Accutase for 5 mins at 38.5 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... All TaqMan probes were 5′-6-carboxyfluorescein (FAM) and 3′-6-carboxy-N,N,N′,N′-tetramethylrhodamine (TAMRA) labeled (Applied Biosystems, US) except TATA-binding protein (TBP ...
-
bioRxiv - Neuroscience 2023Quote: One million cortical cells and one million striatal cells were suspended in 6 mL D-minimum essential medium (DMEM, GIBCO) with 10% foetal bovine serum (DMEM+) ...
-
bioRxiv - Cell Biology 2022Quote: ... DNP (EM 1:6-1:30, #71-3500, Invitrogen), DPP4 (IF/FACS 1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng/ml IL-6 and 10 ng/ml IL-3 (Gibco). Inpp4b+/+ and Inpp4b-/- LSK were each retrovirally transduced with pMSCV-MLL-AF9-IRES-mVenus ...
-
bioRxiv - Microbiology 2023Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g ...
-
bioRxiv - Pathology 2024Quote: ... Cells were subcultured at a 1:3 to 1:6 ratio using Gibco TrypLETM Express Enzyme (12605010, Fisher Scientific) for cell dissociation ...
-
bioRxiv - Neuroscience 2024Quote: ... 20 ng/mL Interleukin-6 (IL-6) (Thermo Fisher Scientific), 20 ng/mL Interleukin-3 (IL-3 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells in one well of 6 well plates were collected in ice-cold PBS (Gibco) and lysed in 200 µL lysis buffer (50 mM Tris-HCl pH 7.0 ...
-
bioRxiv - Cancer Biology 2020Quote: ... One ng/mL recombinant human interleukin (IL)-6 (Gibco, Thermo Fisher Scientific, Waltham, MA, USA), was added to the media of the IL-6 dependent myeloma cell lines INA-6 ...
-
bioRxiv - Microbiology 2023Quote: Vero E6 were seeded in 6-well plates (Falcon) with one glass coverslip (Fisher Scientific) per well ...
-
bioRxiv - Developmental Biology 2019Quote: ... pH=6 (ThermoFisher). Sections were then blocked for 1h at RT with 10% normal donkey serum (Chemicon International Inc ...
-
bioRxiv - Biochemistry 2024Quote: ... or 6% (Thermofisher) tris-glycine SDS-PAGE gels then transferred onto PVDF membranes using the Transblot rapid transfer machine (BioRad) ...
-
bioRxiv - Bioengineering 2020Quote: ... 4’-6-diamidino-1-phenylindole (DAPI, Life Technologies) was applied at 1 μg/mL for 90 minutes to stain the nuclei and the samples were washed and mounted with AquaPoly/Mount (Polysciences) ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with FluorSave (Calbiochem).
-
bioRxiv - Neuroscience 2021Quote: ... propanal (ACROS Organics, 1%, CAS# 123-38-6), and 1,4-diaminobutane (ACROS Organics ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with a FluorSaveTM reagent (Merck-Millipore).
-
bioRxiv - Immunology 2020Quote: ... 6-incubation with 1 μg/mL DAPI (Invitrogen) and 2 μg/mL Wheat Germ Agglutinin (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1 ng/ml IL-6 (Invitrogen, PHC3011)) (Wimmer ...
-
bioRxiv - Developmental Biology 2023Quote: α6-FITC (1:200, Invitrogen, 11-0495-82),
-
bioRxiv - Cancer Biology 2023Quote: ... anti-CD11a (1:50, IBL-6/2, Invitrogen), and FITC anti-PD-1 (1:50 ...