Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Benzofuranethanamine 2 3 dihydro a methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... For nuclear staining 0.5µg/µL of DAPI (4’, 6-diamidino-2-phenylindole, dihydro-chloride, Invitrogen. Cat. No.: D3571) was added along with secondary antibody ...
-
bioRxiv - Cell Biology 2023Quote: ... 2- & 3-methyl pentane and n-hexane (Thermo Scientific, Waltham, MA, USA). Reported compounds detected by the GC-MS were confirmed by matching retention times and mass–charge (m/z ...
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
bioRxiv - Cell Biology 2022Quote: ... dihydro-chloride (DAPI) (Invitrogen. Cat. Nº: D3571) at 0.5 µg/µl ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Zoology 2020Quote: ... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
bioRxiv - Microbiology 2020Quote: ... and 1:1 3-methyl-1-butanol (Thermo Fisher Scientific) in mineral oil were used as cues ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Bioengineering 2022Quote: ... in N-methyl-2-pyrrolidone (NMP) (>99%, Fisher Scientific), after freebasing when necessary.
-
bioRxiv - Physiology 2019Quote: ... and HDMBOA (4,7-dimethoxy-2-{[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy}-3,4-dihydro-2H-1,4-benzoxazin-3-one)) (Block et al., 2019) (Yang et al., 2019) were quantified using HPLC (Thermofisher scientific) which was coupled with MS (UltiMate 3000 HPLC ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... potential was examined using 5,6-dichloro-2-[3-(5,6-dichloro-1,3-diethyl-1,3-dihydro-2H-benzimidazol-2-ylidene)-1propenyl]-1,3-diethyl-,iodide (JC-1 dye) (Life Technologies, USA) as a probe ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Microbiology 2020Quote: ... PobA activity was inhibited with methyl 4-hydroxy-3-iodobenzoate (Fisher Scientific) at a saturating concentration (0.48 mM) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Cell Biology 2019Quote: ... methoxy]-2-oxyethyl] amino]-5-methyl-phenoxy] ethoxy]phenyl-N-[2-[(acetyloxy) methoxy]-2-oxyethyl]-(acetyloxy) methyl ester (Fluo-4/AM) were from Molecular Probes (Invitrogen, Eugene, OR, USA). M ...
-
bioRxiv - Microbiology 2022Quote: The PfHDAC1-2xFKBP-GFP knockin NF54 line parasitized RBCs (mock or 100 nM dihydro artemisinin treated from ∼21-24 HPI/3 hours) were crosslinked using 1% formaldehyde (Thermo Scientific, 28908) for 10 mins at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Biochemistry 2023Quote: ... methyl tert-butyl ether and 2-propanol were from Thermo Fisher Scientific (Pittsburg ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Molecular Biology 2019Quote: The 2′ O-methyl phosphorothioate AOs were transfected into dermal fibroblasts as lipoplexes using 3 μl of Lipofectamine 3000 (Life Technologies, Melbourne, Australia) per 1 ml of OptiMEM ...
-
bioRxiv - Neuroscience 2021Quote: ... Nucleus staining was performed using 4’,6-diamidino-2-phenylindole (DAPI) (3 mM, D3571, Molecular Probes). Cells were counted from four randomly selected fields per culture under a confocal microscope (TCS SP8 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Physiology 2021Quote: 2-3 viable human slices were incubated with Fluo4-AM (6 μM, Invitrogen cat. No. F1221) for 1h in 3 mM HEPES buffer (125 mmol/l NaCl ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 mM MS(PEG)4 Methyl-PEG-NHS-Ester (ThermoFisher Scientific) at 30 °C for 45 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Tris(hydroxymethyl)methyl-3-amino propane sulfonic acid (TAPS) was purchased from Acros Organics. Mal-PEG ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Cell Biology 2021Quote: ... 6′-diamidino-2-phenylindole (Invitrogen). All observations were performed on a Nikon E600 epifluorescence microscope ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 cells (Shanbhag et al., 2010) were cultured in McCoy’s 5A (Modified) Medium (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... DAPI (4’,6-Diamidino-2-henylindole, dihydrochloride) was obtained from Invitrogen (Catalog: D1306, CAS:28718-90-3).
-
bioRxiv - Plant Biology 2023Quote: ... To detect sinapoylmalate and intact indole-3-methyl glucosinolate (I3M) contents, an AcclaimTM RSLC120 C18 column (100 mm x 3 mm, 2.2 µm) (ThermoFisher Scientific, MA) was used in conjunction with mobile phases consisting of solvent A (0.1% formic acid (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... the cerebral cortexes from 2-3 P3-P5 C57BL/6 mice were collected in ice cold HBSS (Invitrogen), the tissue was washed three times with HBSS and digested with 0.04% trypsin (Sigma ...
-
bioRxiv - Genomics 2023Quote: ... All nuclei were pooled and stained with DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306). Using a FACSAria III cell sorter (BD Biosciences) ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were marked with 2,3x10-3 µg/µL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 min at RT in the dark ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were incubated with 2.5 µM DCFH-DA (2’,7’-dichloro-dihydro-fluorescein-diacetate; excitation at 495 nm, emission at 520 nm; Life Technologies, Europe BV, Stockholm, Sweden) in Hank’s buffered saline solution without phenol red for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO-2/3 (Invitrogen); β-Catenin (BD Transduction Laboratories) ...
-
bioRxiv - Microbiology 2019Quote: ... and 3-6 μl Lipofectamin 2000 (Life Technologies). See the Supplemental Information for detailed description.
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen). Slides were mounted in ProLong® Gold antifade reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen) was used for nuclear counterstaining ...
-
bioRxiv - Cell Biology 2019Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen) in SC-LEU media for 45-60 minutes to stain nuclear or mitochondrial DNA (Hanna et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen). After PBS washing ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen) nuclear stain ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen) and mounted with FluoromountG (SouthernBiotech).