Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Amino 5 formamido uracil since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 5% nonessential amino acids (Gibco), and 10% FBS (Gibco ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 mL non essential amino acids (Gibco, Life Technologies), 6 mL 200 mM L-glutamine (Gibco ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 mL non essential amino acids (Gibco, Life Technologies), 6 mL 200 mM L-glutamine (Gibco ...
-
bioRxiv - Bioengineering 2022Quote: ... and 3 mM N-[3-[(4-benzoylphenyl) formamido]propyl] methacrylamide (BPMAC, custom synthesis, PharmAgra) in 1x Dulbecco’s phosphate buffered saline (DPBS, 10x stock, 14200075, ThermoFisher). First ...
-
bioRxiv - Bioengineering 2020Quote: ... 2.5 μM of CellTracker™ Orange 5-(and-6)-(((4-chloromethyl)benzoyl)amino)tetramethyl-rhodamine CMTMR (Molecular Probes, C2927) was used to label iNeuron cells ...
-
bioRxiv - Immunology 2022Quote: ... 5 mM non-essential amino acids (Gibco), 5 mM HEPES (Gibco) ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5% non-essential amino acids (NEAA, ThermoFisher Scientific), 1% 2-Mercaptoethanol ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5 ml MEM Non-Essential Amino Acids (Gibco), 5 ml Sodium pyruvate solution (100 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5% non-essential amino acids (NEAA, ThermoFisher). The BMK-dko cell line was a kind gift from the originator Eileen White ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Cell Biology 2020Quote: ... adapter-ligated template was digested with 5 U of AmpErase Uracil N-Glycosylase (Life Technologies, N8080096). Libraries were then PCR amplified and indexed using Phusion Hot Start II High Fidelity Polymerase (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... adapter-ligated template was digested with 5 U of AmpErase Uracil N-Glycosylase (Life Technologies, N8080096). Libraries were then PCR amplified and indexed using Phusion Hot Start II High Fidelity Polymerase (Thermo Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5% Non-Essential Amino Acids (Thermo Fisher Scientific). The use of patient fibroblasts was approved by the Ethics Committees of the Hospital District of Helsinki and Uusimaa (HUS 387/13/03/2009 and HUS/1187/2019) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mL non-essential amino acids (Gibco, Cat# 11140050), 5 mL GlutaMax (Gibco ...
-
bioRxiv - Genetics 2021Quote: ... 5% minimum essential medium nonessential amino acids (100 ×, Gibco), 5% penicillin and streptomycin (Gibco) ...
-
bioRxiv - Genetics 2021Quote: ... 5% minimum essential medium nonessential amino acids (100 ×, Gibco), 5% penicillin ...
-
bioRxiv - Genetics 2021Quote: ... 5% minimum essential medium nonessential amino acids (100 ×, Gibco), 5% penicillin and streptomycin (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... 5-(and-6)-carboxyfluorescein (FAM) and 5-(and-6)-carboxytetramethylrhodamine (TAMRA) were obtained from Invitrogen™ ...
-
bioRxiv - Cancer Biology 2020Quote: 4-Amino-5-Methylamino-2’,7’-Difluorofluorescein Diacetate (DAF) (ThermoFisher) was used to measure and spatially resolve nitric oxide (NO ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mL MEM Non-essential Amino Acids (Thermo Fisher Scientific), 1 mL 200 mM ascorbic acid (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 ml 100x non-essential amino acids (Gibco #11140-35), 1 mL 500x β-mercaptoethanol (5mM ...
-
bioRxiv - Physiology 2020Quote: ... and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-cytokeratin 5/6 (Invitrogen, MA191106) (1:100 ...
-
bioRxiv - Neuroscience 2019Quote: ... Thiol reactive fluorescent probe IAEDANs (1,5-IAEDANS, 5-((((2-iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic Acid) was purchased from ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were anchored with succinimidyl ester of 6-((Acryloyl)amino) hexanoic acid (AcX) (Thermofisher) in PBS (0.1mg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... SE (6-((acryloyl)amino)hexanoic acid)-labelled fibronectin (A20770, ThermoFisher Scientific; FC010, EMD Millipore), and polymerized on activated glass coverslips for 1 hr at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 mL of MEM Non-Essential Amino Acids Solution (Gibco, Invitrogen), and 500 μL of 2-Mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 mL of MEM Non-Essential Amino Acids Solution (Gibco, Invitrogen), and 500 μL of 2-Mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 5% FBS and non-essential amino acids (Life Technologies). At 4 d post-transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 mL MEM non-essential amino acids (NEAA, Gibco, #.11140-050), 5 mL sodium pyruvate (Gibco ...
-
bioRxiv - Molecular Biology 2021Quote: ... We labeled the purified RLC with 10 molar excess of 5-((((2-Iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (IAEDANS, Invitrogen) or dabcyl C2 maleimide (AnaSpec ...
-
bioRxiv - Biochemistry 2024Quote: ... was labeled with the fluorescent probe 5-((((2-iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (1,5-IAEDANS from Molecular Probes) as previously described (17 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 μL AmpErase Uracil N-Glycosylase (Thermo Fisher Scientific), and 2.0 μL of DNA template in 1 × TaqMan Environmental Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2020Quote: ... including a Uracil-DNA Glycosylase (Thermo Fisher Scientific EN0362) treatment ...
-
bioRxiv - Cell Biology 2021Quote: ... MAN0017058 by Invitrogen (pages 5 and 6). A non-targeting sgRNA that does not recognize any sequence in the human genome was used as a negative control (Invitrogen Cat# ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 ml MEM Nonessential Amino Acids (Thermo Fisher Scientific, cat. no 11140035), 1 ml 200 mM ascorbic acid (Sigma-Aldrich ...
-
bioRxiv - Physiology 2021Quote: ... + 5% FBS + non-essential amino acids (Gibco, Gaithersburg, MD-Stock# 11140-050), penicillin-streptomycin (Gibco ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 ml of MEM non-essential amino acids solution (Thermo Fisher Scientific), 3.5 ml of 2-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: ... and contained 5 µl PowerUp SYBR Green Master Mix with UNG (uracil-N glycosylase to prevent carryover contamination; Thermo Fisher Scientific), 1 µM (panC ...
-
bioRxiv - Biophysics 2023Quote: ... covered with sulfosuccinimidyl 6(4-azido-2-nitrophenyl-amino) hexanoate (sulfo-SANPAH) (ThermoFisher Scientific, Loughborough, UK) 0.5 mg/mL in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Systems Biology 2022Quote: ... 76 mg/L uracil (cat# 157301000, Acros Organics, CA, USA), and various concentrations of [EMIM][OAc] (>95 % purity ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Biochemistry 2022Quote: ... The quality of obtained microsomes was tested with 9-amino-6-chloro-2-methoxyacridine (ACMA; Invitrogen A1324) fluorescence quenching assays.
-
bioRxiv - Molecular Biology 2020Quote: ... samples were treated with 0.5 units of Uracil-DNA glycosylase (Thermofisher) for 15 min at 37°C and used for PCR amplification in a 50 µl reaction volume containing 1 µM of TruSeq barcoded primer p5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.075 μL AmpErase Uracil N-Glycosylase (Thermo Fisher Scientific, MA, USA), and 2.0 μL DNA template in 1× TaqMan Environmental Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... was co-transfected with either pre-gRNA or gRNA expression plasmids (1 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cells were first transfected with the pcDNA3_CasRx-GFP plasmid (2.5 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...