Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 5 Pyrimidinecarboxaldehyde 2 1 1 dimethylethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2019Quote: ... Cells were passaged 1:2-1:6 every 2-5 days by being rinsed once with DPBS (Gibco) and dissociated using 0.5 mM EDTA (75 μl/cm2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Mouse IgG1 anti-alpha Tubulin Clone B-5-1-2 (1:500, ThermoFisher 32-2500), Rabbit anti-Myc polyclonal (1:500 ...
-
bioRxiv - Immunology 2023Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (1 mg, Thermofisher, cat no: A10044) was injected intraperitoneally and mice were sacrificed after 2.5 h ...
-
bioRxiv - Microbiology 2020Quote: ... 20 μl RNase A/T1 mix (2 μg μl−1 / 5 U μl−1, Thermo Scientific) was added to 100 μl lysate (OD260 ~ 150 ...
-
bioRxiv - Neuroscience 2023Quote: ... 47,5% DMEM/F12, 2% B27 w/o Vitamin A, 1% N2 supplement, 1% GlutaMAX, 1% Penicillin/Streptomycin; all from Gibco) supplemented with 10 µM SB-431542 (Torics Bioscience) ...
-
bioRxiv - Neuroscience 2023Quote: ... 47,5% DMEM/F12, 2% B27 w/o Vitamin A, 1% N2 supplement, 1% GlutaMAX, 1% Penicillin/Streptomycin; all from Gibco) supplemented with 10 µM SB-431542 (Tocris Bioscience) ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were incubated with 1 µM 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen) for 6 h (42-48 h post stimulation ...
-
bioRxiv - Genomics 2020Quote: ... 2 µl 5 M NaCl and 1 µl GlycoBlue co-precipitant (Invitrogen). Samples were vortexed and incubated at room temperature for 15 min ...
-
bioRxiv - Immunology 2020Quote: ... The 2× RT mastermix contained 1 μl 5× SuperScript II buffer (Thermofisher), 0.25 μl 100 mM DTT (Thermofisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... with 50-100 nl of 1 mM 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen) at stage 41 ...
-
bioRxiv - Biophysics 2022Quote: ... NPE-caged ATP (adenosine 5’-triphosphate, P3- (1-(2-nitrophenyl ethyl) ester) (Invitrogen) dissolved in attachment buffer was photolyzed in the AFM chamber using an UV light source at 340 nm ...
-
bioRxiv - Cell Biology 2022Quote: ... (B-5-1-2 coupled to Alexa-488, Thermo Fisher or DM1A, Sigma), rat anti-tyrosinated tubulin (YL1/2 ...
-
bioRxiv - Neuroscience 2024Quote: ... the cells were pulsed with 1 mM 5-Ethynyl-2’-deoxyuridine (EdU, Invitrogen) for 3 hr ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Bioengineering 2019Quote: ... The fixed cells were stained with 1 µM 2’-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]-2,5’-bi-1H-benzimidazole trihydrochloride trihydrate (Hoechst 33342, Invitrogen) for 5 minutes ...
-
bioRxiv - Plant Biology 2019Quote: ... Rh (10 µg L-1) and Ir (5 µg L-1) in 2% trace analysis grade (Fisher Scientific, UK) HNO3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5% mercapto-2-ethanol and 1X Halt Protease Inhibitor Cocktail (Thermo Scientific; 1:200). Proteins were separated using SDS-PAGE ...
-
bioRxiv - Microbiology 2019Quote: ... A 2 μl volume of cDNA diluted 1:4 (IAV) or 1:5 (reovirus) in molecular biology grade water (Invitrogen) was added to the 384 well plate ...
-
bioRxiv - Bioengineering 2020Quote: ... The cells were passaged at a density of 1:2 to 1:8 after reaching ~80% confluency by detaching with 5 mM EDTA in PBS (Invitrogen 15575-038 diluted in sterile 1X PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... and incubated in culture media (66% BME, 25% Hanks, 5% FBS, 1% N-2, 1% penicillin, streptomycin and glutamine; all from Invitrogen) and 0.66% D-(+)-Glucose (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... were coated with 100 µL of recombinant SARS-CoV-2 S protein (Wuhan-1 strain and BA.5) at a concentration of 1 µg/mL in PBS (Gibco) at 4°C overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were also stained for 30 minutes simultaneously with 1 μM 2′-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]−2,5′-bi-1H-benzimidazoletrihydrochloride trihydrate (Hoechst 33342, Fisher Scientific) for nuclear visualization and cell localization ...
-
bioRxiv - Molecular Biology 2022Quote: ... pLV-mCherry at ratio 1:1:1 (i.e. 5:5:5 μg) using Lipofectamin™ 3000 transfection reagent (Thermo-Fisher Scientific, #L3000015). Pseudoviruses harvested from the supernatant at 48 h 72h post-transfection were filtered (0.44 μm ...
-
bioRxiv - Bioengineering 2022Quote: ... 1% N-2 (Thermofisher), 2% B-27 (Thermofisher ...
-
bioRxiv - Microbiology 2023Quote: ... 1× N-2 (Gibco), 50 ng/ml of mouse EGF (RnD) ...
-
bioRxiv - Biochemistry 2021Quote: ... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
bioRxiv - Molecular Biology 2022Quote: ... medium (1:1) supplemented with N-2 (Gibco), B-27 (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... claudin-5 (1 μg/ml) and occludin (2 μg/ml; all from Thermo Fisher Scientific). After incubation with primary antibodies membrane was washed with PBS-T three times on a platform rocker and incubated with horseradish peroxidase-conjugated secondary antibody diluted in PBS-T 1:2000 (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recovered nuclei were stained with FITC-conujugated α-5-bromo-2’-deoxyurine (Invitrogen, MoBu-1) in staining buffer (2 mM HEPES pH 7.4 ...
-
bioRxiv - Developmental Biology 2023Quote: Tadpoles were immersed in a solution containing 1 mM EdU (5-ethynyl-2’-deoxyuridine; Invitrogen) before fixation ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes).
-
bioRxiv - Synthetic Biology 2020Quote: ... Cells were subcultured at a 1:5 to 1:10 ratio every 2–3 d using Trypsin-EDTA (Gibco #25300-054). The HEK293FT cell line tested negative for mycoplasma with the MycoAlert Mycoplasma Detection Kit (Lonza #LT07-318).
-
bioRxiv - Cell Biology 2022Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes). Cells were imaged using a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Microbiology 2022Quote: ... 1 ml phenol:chloroform 5:1 pH 4.5 (Thermofisher #AM9720) and 0.5 ml glass beads (Sigma #G8772) ...
-
bioRxiv - Bioengineering 2023Quote: ... The concentrated virus was diluted 1:5 in hepatocyte medium containing N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid buffer (HEPES; 20 mM; Gibco) and 4 μm/mL polybrene (Sigma ...
-
bioRxiv - Synthetic Biology 2024Quote: ... HEK293FT and HEK293FT-LP cells were subcultured at a 1:5 to 1:10 ratio every 2–3 d using Trypsin-EDTA (Gibco 25300-054). All HEK293FT cell lines generated by engineering either the HEK293FT or HEK293FT-LP parent cell lines were cultured in the same way ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... Iba-1 (1:1000, Wako) and COX-2 (1:1000, Thermo Fisher) at 4°C overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... The water contained 1 mg/mL 5-ethynyl-2-deoxyuridine (EdU) (Thermo Fisher Scientific, Cat. # E10187) and 1% sucrose ...
-
bioRxiv - Physiology 2021Quote: ... 1-2 µg of vector DNA was mixed with 5 µl of Lipofectamine™ (Thermo Fisher) in OPTIMEM-I media (GIBCO ...
-
bioRxiv - Immunology 2022Quote: ... 2-5×106 cells were incubated in 15 μl Indo-1 solution in 1ml IMDM (Gibco) + 1%FBS (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were loaded with Fura-2 AM at 1 μg/mL (108964-32-5, Life Technologies) in HBSS or Fluo-4 AM at 10 μM in (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... pH5.8 and 1 µl Glycogen (5 µg µl−1, Ambion) and subsequently pelleted at 12,000 g for 20 min (4 °C) ...
-
bioRxiv - Immunology 2024Quote: ... + 5 % FBS + 1:100 Glutamax + 1:100 MEM-NEAA (Gibco) + 1:100 Sodium Pyruvate + 1:100 Penicillin/Streptomycin solution ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% N-2 (Thermofisher, #17502048), 2% B-27-RA (Thermofisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1× 2-mercaptoethanol (Life Technologies), 100 U/ml penicillin/100μg/ml streptomycin (Life Technologies) ...
-
bioRxiv - Genetics 2021Quote: ... 1% N-2 Supplement (Gibco), 2 mM L-glutamine (Gibco ...