Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 3 methy 5 isobutylhydantion since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... 12.8 % 2-methy 2,4-pentanediol and protease inhibitor cocktail (78429, Thermo Scientific, USA) and incubated for 1 h on ice with shaking ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Plant Biology 2023Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... siCT (5’- CGUACGCGGAAUACUUCGAtt-3’, Ambion), siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-5 μL RNAiMAX (Invitrogen) were added to 500 uL serum-free RPMI-1640 and incubated at room temperature for 5 min ...
-
bioRxiv - Immunology 2019Quote: ... 5’-CCCTACTGTATCCTCATG-3’/5’-CTTACCTCCTCTTCAATAGC-3’ PRKDC: 5’-GGGGCATTTCCGGGTCCGGG-3’/5’-TGCCCTGCCCCCCACTCTGC-3’ Amplicons were cloned using the Zero Blunt TOPO PCR Cloning kit (ThermoFisher), prepared as plasmids ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA primer sets A (KS40 5’-ACCGACCACAGAAACTGCGACTAG -3’ and KS41 5’-AACCTAGTCGCAGTTTCTGTGGTC-3’) and B (KS42 5’-CCGTCCCACTGGCACCGCTTTATG-3’ and KS43 5’-AAACATAAAGCGGTGCCAGTGGGA-3’) were phosphorylated with T4 polynucleotide kinase (ThermoFisher) at 37°C for 30 min and annealed by cooling down from 85°C to 25°C at 0.1°C/sec ...
-
Turanose induced WOX5 restores symbiosis in the Medicago truncatula cytokinin perception mutant cre1bioRxiv - Plant Biology 2020Quote: ... and (MtWOX5) 5’-CACCATGCAGACGGTCCGAGATCTGTC-3’ and 5’- CCTTCGCTTAAGTTTCATGTAA-3’ (AhWOX5) and cloned into pENTR-dTOPO (Invitrogen). The entry clones of AhWOX5 & MtWOX5 recombined through LR clonase Gateway technology (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... the PCR products obtained with 2 primers (AV48_SMCHD1_gPCR_F: 5’-AGGAGCGCGTTTGAATCGG-3’, AV47_SMCHD1_gPCR_R 5’-CTTCGCGTACCTGACACACAC-3’) were TOPO-cloned (Thermo Fisher, #450071) and sent for sequencing.
-
bioRxiv - Molecular Biology 2022Quote: ... siM1-4: 5’ -ACTGGTAGCTTATTAAAGATT- 3’) and the HOXA1 siRNA (5’ - AGAACTTCAGTGCGCCTTATT- 3’) were purchased from Invitrogen™ (Silencer® Select siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Target mtDNA gene (Forward primer: 5′-CACCCAAGAACAGGGTTTGT-3′, Reverse primer: 5′-TGGCCATGGGTATGTTGTTAA-3′, Invitrogen custom primers) and reference 18S ribosomal RNA gene (Forward primer ...
-
bioRxiv - Microbiology 2024Quote: ... This was followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for about 10 min ...
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).
-
bioRxiv - Neuroscience 2022Quote: ... 5’-AAAGCTCGAGCTCTACAAATGTGGTATGGCTG-3’ (Thermo Fisher Scientific). PCR products were purified (Monarch PCR Cleanup Kit (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5’-UAGCGACUAAACACAUCAA-3’ (Thermo Fisher Scientific); RNF168 siRNA #1,siGENOME Smartpool Dharmacon (Cat# M-007152-03) ...
-
bioRxiv - Physiology 2020Quote: ... 5’-UUGAUUUGCUGAGAAGGAC-3’ (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... siRNA#4: 5’-AUAGCGUUUCUUCUAACUGGGCAGC-3’ (Invitrogen). siRNAs #2 and #4 significantly decreased the mRNA levels to the greatest extent and both had the same mitotic phenotypes ...
-
bioRxiv - Microbiology 2020Quote: ... COL1A1 (5’-CGAAGACATCCCACCAATC-3’ and 5’-ATCACGTCATCGCACAACA-3’), ALP (5’-TCACTCTCCGAGATGGTGGT-3’ and 5’-GTGCCCGTGGTCAATTCT-3’) (IDT, Coralville, USA) and viral non-structural (nsP1) gene (Applied Biosystems, USA) (5’-GGGCTATTCTCTAAACCGTTGGT-3’ and 5’-CTCCCGGCCTATTATCCCAAT-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies ...
-
bioRxiv - Genetics 2022Quote: ... mcherry: 5’-ATGGTGAGCAAGGGCGAGGAG-3’ and 5’-CTTACTTGTACAGCTCGTCCATG-3’) from pKHR8-foxc1aKI and separately subcloned into pJET2.1 (ThermoFisher) to give pJET-mVenus and -mCherry ...
-
bioRxiv - Neuroscience 2024Quote: ... The siRNA sequence for YTHDF2 is 5′-AAGGACGTTCCCAATAGCCAA-3′ and for HIF1α is 5’-GCTGATTTGTGAACCCAT-3’ (Ambion). After 48 h from the initial transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The pbf1 gene of johansen Standard was amplified with the primer pair psbNRO_F 5’-AGCATTGGGAGGCTCATTAC-3’ and psbNRO_R 5’-GGAAACAGCAACCCTAGTCG-3’ and cloned into to pCRTM2.1-TOPO® (Invitrogen). The vector was linearized with HindIII and in vitro transcription was performed according to the suppliers’ protocol ...
-
bioRxiv - Microbiology 2020Quote: ... RdRp_rev 5’-CAAATGTTAAAAACACTATTAGCATA-3’ RdRp_probe 5’-FAM-CAGGTGGAACCTCATCAGGAGATGC-TAMRA-3’) and/or TaqMan gene expression assays (Applied Biosystems) for ACTB (Hs99999903_m1) ...
-
bioRxiv - Immunology 2022Quote: ... and their corresponding FAM-labelled MGB probes (εGLT: 5′-AGGCACCAAATG-3′ and γ1GLT: 5 ′-CTCAGCCAGGACCAAG-3′) (Applied Biosystems) were designed in house ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’- CCACCCTCCAGCCAATC-3’ and FAM/ZEN-labeled probe 5’-ACAGGGCAACCATTGGCTCG-3’ with Taqman Gene Expression Master Mix (ThermoFisher).
-
bioRxiv - Microbiology 2023Quote: The embB region containing codon 406 was amplified using PCR primers F1 5’-TGATATTCGGCTTCCTGCTC-3’ and R1 5’-TGCACACCCAGTGTGAATG-3’ designed using Primer3 (23) (version 0.4.0) and acquired from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA targeting topoisomerase 2beta (5’CGAUUAAGUUAUUACGGUUtt 3’, s106; 5’ GAGUGUACACUGAUAUUAAtt 3’, s108; both purchased at Ambion/ThermoFIsher Scientific), TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA targeting topoisomerase 2beta (5’CGAUUAAGUUAUUACGGUUtt 3’, s106; 5’ GAGUGUACACUGAUAUUAAtt 3’, s108; both purchased at Ambion/ThermoFIsher Scientific), TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’ ...
-
bioRxiv - Cell Biology 2019Quote: RNF168 si #1: 5’- GGCGAAGAGCGAUGGAGGATT-3’ (Ambion)
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP7 siRNA: 5’-GCAACACUUAGAAGGAGAAGGCCUA-3’ (1362318, Invitrogen); GTPBP8 siRNA#1 ...
-
bioRxiv - Cell Biology 2023Quote: DCAF5 5‘-GCAGAAACCUCUACAAGAAdTdT-3’ (Ambion, silencer select)
-
bioRxiv - Cell Biology 2020Quote: ... #3: 5′-GAAUAUUGAACUGGAAGCAGCACAU-3′) were purchased as Stealth RNAi siRNAs from Invitrogen. The target sequences were designed using the Block-iT RNAi Designer tool (Invitrogen ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...