Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 14 3 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-14-3-3γ 1:2000 (Thermo fisher PA5-29690) and mouse anti-GAPDH (CSB-MA000195 ...
-
bioRxiv - Neuroscience 2023Quote: ... GST-14-3-3s constructs (Invitrogen) were transformed into Escherichia coli strain BL21 (DE3 ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 ng/mL recombinant murine interleukin-3 (IL-3) (Gibco). Cells were grown in a humidified incubator at 37 °C and 6% atmospheric CO2 ...
-
bioRxiv - Physiology 2020Quote: ... 14-3-3ζ-specific siRNA (Ambion, Austin, TX), GFP control plasmids ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 3 μM SYTO™ 14 (Invitrogen, cat #: S7576), 5 μg/mL WGA-Alexa 555 (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... α-SMA mAb (Invitrogen, 14-9760-82), Ki67 mAb (Cell Signaling Technology ...
-
bioRxiv - Biochemistry 2021Quote: ... supplemented with recombinant murine IL-3 (Gibco, PMC0035) at 1 μg/mL (BaF3) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 10ng/ml recombinant human IL-3 (Gibco). Cultured cells were infected with lentivirus encoding GFP/Scrambled control shRNA overnight and fresh media was added the following day ...
-
Interaction of the Xanthomonas effectors XopQ and XopX results in induction of rice immune responsesbioRxiv - Molecular Biology 2020Quote: ... The eight rice 14-3-3 genes cloned in the yeast two-hybrid vector pDEST22 (Invitrogen) were used from a previous study (Deb et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-Galectin-3 (1:200, Invitrogen, 14-5301-82); rabbit anti-Fibronectin (1:500 ...
-
bioRxiv - Cell Biology 2020Quote: ... CDC20 was depleted using siRNA oligo #14 5’-CGGAAGACCUGCCGUUACA-3’ (ThermoFisher). siRNA oligos for PP2A-B55 and PP2A-B56 have been described (Hayward et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 10 ng/mL recombinant mouse interleukin-3 (Gibco PMC0031).
-
Interaction of the Xanthomonas effectors XopQ and XopX results in induction of rice immune responsesbioRxiv - Molecular Biology 2020Quote: The wild-type copy of the xopX gene and its 14-3-3 protein binding motif mutants were cloned in the yeast two-hybrid vector pDEST32 (Invitrogen) using the Gateway cloning system (Invitrogen ...
-
Interaction of the Xanthomonas effectors XopQ and XopX results in induction of rice immune responsesbioRxiv - Molecular Biology 2020Quote: The wild-type copy of xopX and its 14-3-3 protein binding motif mutants were cloned by Gateway cloning (Invitrogen, California) from the pENTR clones to the BiFC vector pDEST-VYCE(R)GW carrying the C-terminal region of the Venus Fluorescent Protein (VFP ...
-
bioRxiv - Physiology 2019Quote: ... Claudin-3 (rabbit; Cat #34-1700, Invitrogen), Occludin (rabbit ...
-
bioRxiv - Physiology 2019Quote: ... Claudin-3 (rabbit; Cat #34-1700 Invitrogen), Occludin (rabbit ...
-
bioRxiv - Microbiology 2024Quote: ... Purified cDNA was amplified for 25 cycles with VSG specific primers: a spliced-leader (5’-ACAGTTTCTGTACTATATTG-3’) and SP6-VSG 14-mer (5’-GATTTAGGTGACACTATAGTGTTAAAATATATC-3’) using Phusion polymerase (Thermo Scientific, F530L) (annealing temp 55C ...
-
bioRxiv - Microbiology 2024Quote: ... 2uL of RNase-treated cDNA was amplified for 35 cycles with VSG specific primers: a spliced-leader (5’-ACAGTTTCTGTACTATATTG-3’) and SP6-VSG 14-mer (5’-GATTTAGGTGACACTATAGTGTTAAAATATATC-3’) using Phusion polymerase (Thermo Fisher, F530L) (annealing temp 55C ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-Vinculin 3:10000 (ThermoFisher Scientific, 700062) and mouse anti-GAPDH 1:1000 (Santa Cruz ...
-
bioRxiv - Neuroscience 2022Quote: ... 3) donkey anti-rabbit 488 (1:250, Invitrogen). To visualize immunofluorescence ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 5ug of 14-3-3ζ expression plasmid DNA utilizing lipofectamine 2000 (Thermo Fisher Scientific) following manufacturers protocol ...
-
bioRxiv - Zoology 2022Quote: ... DsRNA concentrations were adjusted to 3 or 14 μg / μl using SpeedVac Concentrator (Thermo Scientific) and their integrity was checked on agarose gels ...
-
bioRxiv - Cell Biology 2022Quote: ... Vinculin Rabbit mAb (# 700062; Invitrogen), p-H3 Rabbit mAb (S10 ...
-
bioRxiv - Bioengineering 2021Quote: ... or rabbit anti-caspase-3 (1:500, ThermoFisher #700182) followed by Alexa-conjugated anti-mouse or anti-rabbit secondary antibodies for 8 hours each at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... and rabbit anti-vinculin (3:10,000; ThermoFisher Scientific, 700062). Secondary antibodies were used in 5% non-fat dried milk in TBS-T for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-Neuroligin-3 (1:1000, Thermo Fisher Scientific), rabbit anti-COX-2 (1:1000 ...
-
bioRxiv - Microbiology 2022Quote: ... rabbit mAb (#4394); IKKβ (D30C6) rabbit mAb (#8943); phospho-IKKα (Ser176)/IKKβ (Ser177) (C84E11) rabbit mAb (#2078; blocked with SuperBlock (Thermo Scientific)) ...
-
bioRxiv - Cell Biology 2023Quote: The siRNA sequences targeting human 14-3-3β (GenBank accession number: NM_003404.4) and human 14-3-3σ (GenBank accession number: NM_006142.5) were synthesized by ThermoFisher Scientific Ink (Massachusetts ...
-
bioRxiv - Microbiology 2020Quote: Recombinant human mAbs were expressed in Expi293 HEK cells (Life Technologies), which were maintained in suspension at 37°C and 8% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant mAbs were then produced in EXPi293F cells (Life Technologies, USA) by transfecting pairs of the IgG1 heavy and light chain expression plasmids ...
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Microbiology 2022Quote: Anti-ORF8 mAb (#1-3-2) was coupled to aldehyde/sulfate latex beads (Thermo Fisher Scientific A37304). The antibody was mixed with the latex beads and shaken at room temperature overnight ...
-
bioRxiv - Biophysics 2024Quote: ... The 3 mAbs were specifically conjugated to HRP using EZ-Link™ Plus Activated Peroxidase Kit (ThermoFisher) and detected with ECL (Pierce ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Genetics 2023Quote: ... and the random primer 5′-GTTTCCCAGTCACGATCNNNNNNNNNNNNNNN-3′ for the RT step and recombinant Taq polymerase (Invitrogen) for the PCR step using D388 specific primers 5′-GAGAGAAGGATTAGATTGTG-3′ and 5′-CCTGTATAATAGAAGTACCA-3′ ...
-
bioRxiv - Immunology 2022Quote: ... or 50 µg Rat anti-Langerin mAb (Isotype IgG2a; #14-2075-82, Thermo Fisher). At 12h or 24h post-antibody administration ...
-
bioRxiv - Cancer Biology 2023Quote: ... were co-transfected with lentiviral expression construct (3 µg) using Lipofectamine 2000 (14 µl; Life Technologies, 11668-019) into HEK-293T cells to generate lentivirus ...
-
bioRxiv - Immunology 2023Quote: ... Cy-3 conjugated anti-rabbit secondary antibody (Invitrogen, 1:300 dilution) was added and incubated for 0.5 hr ...
-
bioRxiv - Microbiology 2023Quote: ... cells were blocked for 1 h in 3% BSA/PBS and incubated with rabbit-anti-GFP (1:50 in 3%BSA/PBS, 200 µl/well, Invitrogen, G10362) for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... The resin was subsequently washed with 3 resin volumes (RV) of the same buffer before mAb P3.2 (Thermo Fisher) was eluted using 3 RV of 0.2 M glycine pH 2.5 ...
-
bioRxiv - Immunology 2022Quote: Recombinant tri-S protein was heat-denatured at 100°C for 3 min in loading buffer (Invitrogen) containing 1X sample reducing agent (Invitrogen) ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2019Quote: Mouse TGF-β 1 recombinant protein was obtained from Affymetrix (#14-8342-62) and used at the concentration of 2 ng/ml unless stated otherwise ...
-
bioRxiv - Cell Biology 2020Quote: ... rabbit anti-centrin-3 (1:1000; PA5-35865; Thermo Scientific, Rockford, USA), rabbit anti-acetylated α-tubulin (1:800 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and rabbit anti-activated Caspase-3 (Fisher Scientific/BD, BDB559565, 1:500). Antibody used for fluorescent in situ hybridization was mouse anti-Dig (Jackson ImmunoResearch 200-002-156 ...
-
bioRxiv - Biochemistry 2022Quote: ... After washing 3 times Alexa Fluor 594 coupled anti-rabbit (Life Technologies) was added at a dilution of 1:500 for 1h at RT ...
-
bioRxiv - Systems Biology 2021Quote: ... secondary mAB anti-goat HRP (rabbit, Invitrogen, 611620), secondary mAB anti-mouse (sheep ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... FluoZin-3 (FluoZin™-3, AM, cell permeant, Thermo Fisher) was added at 1 mM ...