Labshake search
Citations for Thermo Fisher :
3451 - 3500 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and 5 µM MitoSOX™ Red (Thermo Fisher Scientific, Waltham, USA) for 30 min ...
-
bioRxiv - Immunology 2024Quote: ... Tilt series were acquired using Tomography 5 (version 5.5.0; ThermoFisher Scientific) in counting mode at 49,000× magnification with a pixel size of 1.74 Å using a dose-symmetric scheme from 0° to +/-57° ...
-
bioRxiv - Immunology 2024Quote: ... 5 mg antibody was reduced with Bond-Breaker TCEP solution (ThermoFisher) for 1 hour at 37°C then desalted with Zeba 7 kDa spin columns to remove TCEP ...
-
bioRxiv - Immunology 2024Quote: ... 5 mM β-mercaptoethanol and 500 µg/ml G418 sulphate (Invitrogen)) ...
-
bioRxiv - Cell Biology 2024Quote: ... All siRNA transfections were performed using RNAiMAX (5 µL; Thermo Fisher) and OptiMEM (400 µL ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µl of Trypan blue (Thermo Fisher Scientific, cat. no. T10282) was mixed with 5 µl of the sample and loaded onto an INCYTO C-Chip Disposable Hemocytometer ...
-
bioRxiv - Cell Biology 2024Quote: ... All siRNA transfections were performed using RNAiMAX (5 μL; Thermo Fisher) and OptiMEM (400 μL ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μL QuantStudio 3D Digital PCR Master Mix V2 (ThermoFisher Scientific) and 3 μL water for a final volume of 10 μL ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% NP-40 and 5 mM EDTA) (Thermo Scientific, J60766-AP) supplemented with Halt Protease Inhibitor Cocktail (Thermo Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... mixed with 5 uL 4x NuPAGE LDS Sample Buffer (Thermo Fisher) and heated to 70*C for 10 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... samples were incubated in 5 µM BODIPY 493/503 (Invitrogen, #D3922) in PBS and subsequently washed 3 times with PBS and fixed in 4 % PFA for 15 min ...
-
bioRxiv - Cell Biology 2023Quote: ... and a pre-column 5 mM PepMapTM C18 trap (ThermoFisher Scientific). Buffer A was 0.1 % formic acid in HPLC water ...
-
bioRxiv - Genetics 2023Quote: ... supplemented with 5% heat-inactivated fetal bovine serum (ThermoFisher Scientific 16140071), 2 mM L-glutamine (Corning 25-005-CI) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and qRT-PCR was conducted on a QuantStudio 5 (Applied Biosystems) with Power SYBR Green PCR Master Mix (Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were blocked with 5% bovine serum albumin (Thermo Fisher Scientific) in tris-buffered saline with 0.2% Tween®20 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg of RNA was treated with DNaseI (Thermo Scientific, 18068015) in the presence of SUPERase-In (Thermo Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse anti-claudin-5 (Invitrogen, cat# 35-2500, AB_2533200, 1:200), rabbit anti-ZO-1 (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... plasma was removed and 5 μg/μL Sytox Green (Molecular Probes) diluted in 200 μL sterile seawater was added to each well ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was labeled with 5 g/ml Hoechst 33342 (Molecular Probes). To detect cells with compromised plasma membrane integrity indicative of cell death ...
-
bioRxiv - Neuroscience 2022Quote: ... that were incubated for 5 min in Hoechst 33342 (Invitrogen, USA). Then ...
-
bioRxiv - Neuroscience 2022Quote: ... and 5 % FBS in neurobasal media (Gibco, Life Technologies #12348-017)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.3 uL RNAiMax in 5 uL OptiMEM (Gibco, Thermo Fisher Scientific). The cells were seeded into 96-well cell culture plates containing culture medium with DMSO or inhibitors.
-
bioRxiv - Molecular Biology 2023Quote: ... and subsequently coated with 5 μg/mL of mouse laminin (Gibco) in DPBS at 37°C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... GlutaMAX™ (Thermo) supplemented with 5% fetal calf serum (FCS, Gibco) and 100 μg/ml penicillin-streptomycin ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 minutes) using a TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) using specific primers (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.25 ul 10 uM TaqMan probe (5’ TTAGATCCTAGCTCACGTGTC; Applied Biosystems, #5371391), 1 ul DNA template ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μL of 5-fold SYPRO Orange (Thermo Fisher, S6650) was added to each well ...
-
bioRxiv - Cell Biology 2023Quote: ... on a QuantStudioTM 5 real-time PCR system (Thermo Fisher Scientific). The 2- ΔCt method was used to analyze the data using GAPDH and tyrosine 3- monooxygenase/tryptophan 5-monooxygenase activation protein zeta (YWHAZ ...
-
bioRxiv - Immunology 2023Quote: ... cells were incubated with PE-coupled neutravidin (Invitrogen, 5 µg/mL) for 30 minutes at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... and 5 % FBS in neurobasal media (Gibco, Life Technologies #12348-017)) ...
-
bioRxiv - Bioengineering 2023Quote: ... and ABI Quantstudio 5 Detection System (Applied Biosystems, Carlsbad, CA,USA). the reaction volume and conditions were described in previous study (Wu et al ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, 41965-039) supplemented with 10% heat-inactivated FBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of TaqMan Fast Virus 1-Step Master Mix (ThermoFisher), and 9 μl of molecular-grade water per reaction ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were preloaded with 5 μM CellROX deep red reagent (Invitrogen) for 15 min at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Alexa 488 conjugated Claudin-5 (1:500; Invitrogen, 35-358-8), rabbit anti-CCL2 (1:500 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplification was performed using Applied Biosystems QuanStudio ®5 (Applied Biosystems). Primer sequences are shown in Supplementary Table 3.
-
bioRxiv - Systems Biology 2023Quote: ... using QuantStudio 5 Real-Time PCR System (Thermo Fisher, Waltham, MA). The first sequencing was performed on NextSeq 2000 sequencer (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using TryplE (Gibco 12604054). Naïve and primed hPSCs were expanded and induced into different lineages in a 5% CO2 incubator at 5% O2 at 37C.
-
bioRxiv - Genomics 2023Quote: ... supplemented with 5% heat-inactivated fetal bovine serum (Life Technologies #16000044), 1 mM GlutaMAX (Life Technologies #35050079) ...
-
bioRxiv - Developmental Biology 2023Quote: 5 x 104 cultured PGCs were washed with OPTI-MEM (Gibco) and placed in 96 well plate containing 100 μl of FAot medium53 (adding Ovo-transferrin instead of chicken serum ...
-
bioRxiv - Plant Biology 2023Quote: ... Native PAGE™ 5% G-250 Sample Additive (BN2004, Invitrogen™) was added to the supernatant at a final concentration of 0.125% ...
-
bioRxiv - Bioengineering 2023Quote: ... and then blocking buffer was added (5% normal goat serum [ThermoFisher] ...
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked in PBST + 5% of Horse serum (ThermoFisher 16050-122) for 5 hours at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... previously coated with 5 μg fibronectin (Life Technologies 428 33016-015). Cells were transiently transfected with 100 ng of empty vector ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μM of the Ca2+-sensitive dye Rhod-2AM (Molecular Probes), 20 μM blebbistatin (a myosin ATPase inhibitor (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... myotubes were incubated with 5 µM MitoSOX™ Red (Molecular Probes) for 20 min at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 and 7 using an EVOS M5000 cell imaging system (ThermoFisher). ImageJ was used to determine fluorescent intensity on each of these days.
-
bioRxiv - Cell Biology 2023Quote: ... followed by digestion in Collagenase IV (Life Technologies; 5 mg/ml), DNase I (Roche ...
-
bioRxiv - Cell Biology 2023Quote: Primary hepatocytes pooled from ‘5-Donor’ human hepatocytes (Thermo Fisher Scientific) were thawed and cultured in William’s E medium supplemented with primary hepatocyte supplements (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 µl of a 300 µM intermediate concentration of DAPI (Invitrogen by Thermo Fisher Scientific ...