Labshake search
Citations for Thermo Fisher :
301 - 350 of 3282 citations for CEPT1 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: All siRNAs are from Thermo Fisher Scientific with the specific Assay IDs as follows ...
-
bioRxiv - Cell Biology 2019Quote: All siRNAs were purchased from Ambion and contained the Silencer Select modification ...
-
bioRxiv - Cancer Biology 2021Quote: ... silencer select negative siRNA (4390843, Ambion) was used as transfection control.
-
bioRxiv - Cell Biology 2020Quote: ... siRNAs were transfected using RNAiMAX (Invitrogen), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... rabaptin5 siRNA (5’CCGGGCAAUUCUGAAUGAUACUAAA3’ from Invitrogen) and scramble siRNA (non-targeting pre-designed ID 12935112 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 siRNA (Thermo Fisher Scientific, 4390843). miRNA inhibitors were purchased from Qiagen as miRCURY LNA miRNA inhibitors ...
-
bioRxiv - Cell Biology 2020Quote: ... for siRNAs and Lipofectamine 2000 (Invitrogen) for plasmids according to the instructions of the manufacturer ...
-
bioRxiv - Molecular Biology 2022Quote: ... were purchased from Invitrogen™ (Silencer® Select siRNA; Thermo Scientific). RA was added to 10 μM 6h after transfection to induce neuronal differentiation ...
-
bioRxiv - Molecular Biology 2022Quote: ... and transfected with Selenbp1 siRNA (Invitrogen) with use of RNAiMAX transfection reagent (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 siRNA (Thermo Fisher Scientific, #4390843) was used as a non-targeting siRNA (siCtrl) ...
-
bioRxiv - Cell Biology 2024Quote: ... Scrambled siRNA (Invitrogen; Catalog number: AM4613) was used as negative control (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... All siRNAs were purchased from Ambion.
-
bioRxiv - Cell Biology 2024Quote: ... 1 siRNA (ThermoFisher, item number 4390843) or Silencer™ Select Pre-designed Chk2 siRNA (ThermoFisher ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... a negative control siRNA (Invitrogen, 4390843), or a null transfection condition using the Lipofectamine RNAiMAX Transfection Reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA#4: 5’-AUAGCGUUUCUUCUAACUGGGCAGC-3’ (Invitrogen). siRNAs #2 and #4 significantly decreased the mRNA levels to the greatest extent and both had the same mitotic phenotypes ...
-
bioRxiv - Cell Biology 2023Quote: ... or VAP-A+B siRNA (Ambion Silencer Select Pre-Designed siRNAs ...
-
bioRxiv - Immunology 2023Quote: ... siRNA using Neon Transfection System (Invitrogen) with the following setting ...
-
bioRxiv - Cell Biology 2023Quote: ... Silencer Select siRNA (Thermo Fisher Scientific) against CDKN2A (ID ...
-
Phosphoproteomics of cellular mechanosensing reveals NFATC4 as a regulator of myofibroblast activitybioRxiv - Systems Biology 2023Quote: ... 1 siRNA (Thermo Fisher Scientific, #4390843) were used for RNAi ...
-
Reduction of Spermine Synthase Suppresses Tau Accumulation Through Autophagy Modulation in TauopathybioRxiv - Neuroscience 2023Quote: Co-transfections of siRNA (s13173, ThermoFisher) and plasmids expressing EGFP (pEGFP-C1 ...
-
bioRxiv - Immunology 2023Quote: ... or three siRNAs for UBXD1 (ThermoFisher silencer select # s37291 ...
-
bioRxiv - Cell Biology 2023Quote: Three kinds of Klf4 siRNA (Ambion, Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... siRNAs were purchased from Thermo Fisher Scientific (Silencer Select siRNA) ...
-
bioRxiv - Molecular Biology 2023Quote: Stealth RNAi siRNAs (Thermo Fisher Scientific) were used for RNA interference ...
-
bioRxiv - Cancer Biology 2023Quote: siRNA against IFT88 (ID: 149319, Ambion) or Negative Control siRNA (Cat# 1027310 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or a control siRNA (Thermofisher, #AM4611), at a final concentration of 10nM ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNAs were purchased from Thermo Fisher: siBRD4#1 (s23901) ...
-
bioRxiv - Cell Biology 2023Quote: ... or 50 nM BICD2 siRNA (Invitrogen Silencer™ select BICD2 ...
-
bioRxiv - Cancer Biology 2023Quote: All siRNAs were purchased from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 siRNA (4390843; Thermo Fisher Scientific) was used as well.
-
bioRxiv - Cell Biology 2023Quote: ... The non-targeting siRNA from Thermofisher Scientific (silencer select ...
-
bioRxiv - Molecular Biology 2023Quote: ... siRNAs were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: Small interfering RNAs were purchased from ThermoFisher Scientific (Validated Silencer Select siRNA, Ambion). For each selected UPS factor ...
-
bioRxiv - Cell Biology 2023Quote: Custom siRNAs were purchased from Ambion/Thermo Fisher (Waltham ...
-
bioRxiv - Biochemistry 2024Quote: siRNAs were transfected using RNAiMAX (Invitrogen) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... The Silencer Pre-Designed siRNAs (Ambion) used were SEC31A (147540) ...
-
bioRxiv - Cell Biology 2024Quote: Reduction of hybrid receptor expression in HUVECs was carried out by transfection of validated human siRNA duplexes of insulin receptor (Silencer™ Pre-Designed siRNA, Invitrogen; Catalog number: AM51331, siRNA ID:29) and IGF-1 receptor (Catalog number ...
-
bioRxiv - Immunology 2024Quote: ... Aliquoted 108 μL T buffer containing suspended cells was mixed with 12 μL of siRNA solution (20 μM for Invitrogen siRNA, and 1 μM for IDT siRNA) or plasmid solution (6 μg plasmid DNA/12 μL TE buffer) ...
-
bioRxiv - Cancer Biology 2021Quote: ... siRNA knockdown of BCKDK was performed using Ambion silencer select siRNA oligonucleotides (Thermo-Fisher Scientific Cat# 4390824). The siRNAs used in this paper were siBCKDK#1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Non-silencing control and Six1- or Mct10-targeting siRNA duplexes were obtained from Invitrogen (Stealth siRNA technology) and reconstituted at 20 µM ...
-
bioRxiv - Immunology 2022Quote: ... siRNAs and scrambled controls (scRNAs) were synthesized following directions from the Silencer siRNA Construction Kit (Invitrogen, AM1620) using the primers listed in Supplemental Table 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Non-targeting control siRNA and siRNA targeting USP11 were transfected into cells using Lipofectamine RNAi MAX (Invitrogen) following the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2019Quote: ... BC cells were transfected with SIX1 siRNAs or control siRNA using Lipofectamine™ 3000 Reagent (Invitrogen, USA) according to the manufacturer’s instruction.
-
bioRxiv - Cell Biology 2021Quote: ... The following siRNAs were used: Stealth RNAi siRNA negative control (Negative Control, Med GC, Thermo Fisher Scientific), stealth RNAi for Myoparr ...
-
bioRxiv - Cancer Biology 2021Quote: ... Assays utilizing pooled siRNA (Horizon; ON TARGETplus siRNA) were conducted by first transfecting with RNAiMAX (Invitrogen; #13778100) 72h prior to exposure to individual PARP inhibitors to ensure maximum knockdown at initial treatment.
-
bioRxiv - Cell Biology 2020Quote: ... whereas Kif18A siRNA treated with 100 nM Silencer Select Validated Kif18A siRNA (s37882; Ambion, Austin, TX, USA). All transfections were performed using Nucleofector Kit R with the Nucleofector 2b Device (Lonza ...
-
bioRxiv - Cell Biology 2019Quote: ... C2C12 myoblasts were transfected with either control siRNA (Silencer™ Negative Control No. 1 siRNA; Invitrogen # AM4611) or a mixture of four siRNA pool targeting mPOU (ON-TARGET plus SMART pool ...
-
bioRxiv - Molecular Biology 2022Quote: siRNA for rat-c-MAF (4390771) and its negative control siRNA (4390843) were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with either NTC-siRNA or MCT1-siRNA using lipofectamine RNAi Max (Thermofisher, cat 13778075) for 6 hours in less serum optiMEM media (Thermofisher ...
-
bioRxiv - Physiology 2023Quote: ... and 50 nM scrambled siRNA with similar median GC content was used as siRNA control (#12935300, Invitrogen). Transfection was carried out according to the manufacturer’s instructions ...