Labshake search
Citations for Thermo Fisher :
3401 - 3450 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... 5 μg RNA was treated with TURBO™ DNase (Invitrogen #AM2238) and 500 ng of this was used for cDNA synthesis with oligo-dT primer using RevertAid H Minus First Strand cDNA Synthesis (Thermo Scientific #K1632) ...
-
bioRxiv - Zoology 2022Quote: ... 5 µl 2X Platinum™ Multiplex PCR Master Mix (ThermoFisher Scientific), 1 µl 10X primer mix and 3 µl H2O ...
-
bioRxiv - Microbiology 2022Quote: ... washed 5 times and mounted in Prolong Gold antifade (ThermoFisher Scientific). Samples were imaged on the Zeiss LSM780 confocal microscope.
-
bioRxiv - Cancer Biology 2024Quote: ... and 1X Mammary Epithelial Growth Supplement (MEGS, Invitrogen S-015-5). Mycoplasma contamination was frequently assessed by PCR ...
-
bioRxiv - Neuroscience 2022Quote: ... Saturated cultures were serially diluted 1:5 in sterile PBS (Gibco). To SC –ura -his glucose or galactose agar plates ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 5% FBS and non-essential amino acids (Life Technologies). At 4 d post-transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 μL of TaqMan™ Genotyping Master Mix (Applied Biosystems; 4371353), 0.5 μL of assay probes (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2022Quote: ... in a Quant Studio 5 Real-Time PCR System (Applied Biosystems, ThermoFischer Scientific AG ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-time PCR was performed with QuantStudio™ 5 (Thermo Fisher).
-
bioRxiv - Microbiology 2022Quote: ... using the QuantStudio™5 Real-Time PCR system (Applied Biosystems), which has been described in detail (31) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Multidrop™ Combi Reagent Dispenser (ThermoFisher, green in scheme 1-5) or manually (grey in scheme 1-5).
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 μl Taq polymerase (5 U/μl; Thermo Scientific; Dreieich, Germany), 1 μl of each primer (10 mM) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 mL additional L-glutamine (GIBCO 25030-081; stock 200 mM), 10 mL MEM nonessential amino acids (GIBCO 11140076 ...
-
bioRxiv - Molecular Biology 2022Quote: qPCR samples were analyzed on a QuantStudio 5 System (Applied Biosystems) with a passive reference of ROX and analyzed by QuantStudio 5 software using the Relative Standard Curve setting.
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were blocked with 5% bovine serum albumin (Thermo Fisher Scientific) in tris-buffered saline with 0.2% Tween®20 (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... the cells were incubated with 5 µM of DeepBlueC (Molecular Probes). The measurements were done with Mithras LB940 (Berthold Technologies ...
-
bioRxiv - Immunology 2022Quote: ... including 5 mg protein and 5000× SYPRO Orange (Invitrogen, Carlsbad, USA) as fluorescence probe ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μg/ml streptomycin was also added (Fisher Scientific, Waltham, MA). Mycobacterium smegmatis (ATCC 700084 ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were blocked with 5% bovine serum albumin (Thermo Fisher Scientific) in tris-buffered saline with 0.2% Tween®20 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... The RNA Sel25 oligonucleotide (5’GGACAGGAAUUAAUAGUAGCUGUCC3’) was obtained from Invitrogen (USA) along with a FITC tagged version on the 5’ extreme ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL Proteinase K (10 mg/ml) (Thermo Scientific™, EO0491) were used and incubated at 55°C for 1h with vigorous pipetting every 15 minutes ...
-
bioRxiv - Plant Biology 2024Quote: ... respectively were stained with EdU (5-ethynyl-2′-deoxyuridine; Thermo Fisher) and modified pseudo-Schiff propidium iodide (PI ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 5 μL of TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and 1 μL of cDNA ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNAs targeting DHHC 2 and 5 were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM EGTA) supplemented with Halt Protease/Phosphatase inhibitor (Thermo Fisher). Biotinylated proteins were captured using nanolink Streptavidin magnetic beads (Solulink ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 ml (cat no. 89892) were procured from Thermo Scientific (USA). Streptavidin agarose (cat no ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with 5% FBS devoid of charcoal (Gibco, ref: 12676-029) during treatment.
-
bioRxiv - Biochemistry 2024Quote: ... 5-(Pentafluorobenzoylamino) Fluorescein Di-β-D-Glucopyranoside (PFB-FDGlu, ThermoFisher Scientific) was used to evaluate GCase activity in live cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then 5 µl of CFSE (Life Technologies, Invitrogen, Massachusetts, US) was added to the cell suspension and incubated at 37 °C for 15 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then 5 µl of CFSE (Life Technologies, Invitrogen, Massachusetts, US) was added to the cell suspension and incubated at 37 °C for 15 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 nL of 5 mM TCEP (Thermo Fisher Scientific, Waltham, MA) containing 0.05% n-dodecyl-β-d-maltoside (DDM ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by two 5 min washes in 5x SSC (ThermoFisher, AM9770). Samples were then incubated for 15-30 min in pre-warmed probe hybridization buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... and stained with 5 μM MitoSOXTM Red (Invitrogen, Cat. No. M36008) in Hank’s balanced salt solution with calcium and magnesium (HBSS/Ca2+/Mg2+ ...
-
bioRxiv - Microbiology 2024Quote: ... Columbia agar plates with 5% sheep blood (Thermo Fisher Scientific, PB5039A) were streaked with the corresponding glycerol stocks ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 5% heat-inactivated fetal calf serum (FCS; Life Technologies), 1% penicillin/streptomycin (PS ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μL of 100bp DNA ladder (SM0243, Thermo Fisher Scientific, USA) was added and 10 μL PCR products were added in the remaining wells along with positive and negative control ...
-
bioRxiv - Systems Biology 2024Quote: ... 5 % CO2 and 95 % rH in Dulbecco’s Modified Eagle’s Medium (Gibco), supplemented with 20 % (v/v ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5 μM (final concentration) of a fluorogenic probe (MitoSOX, Invitrogen™) was added to each well after incubation with PDA ...
-
bioRxiv - Neuroscience 2024Quote: ... Rabbit-hosted antibodies [anti-Claudin-5 (1:100, 34-1600, Invitrogen), and anti-Iba-1 (1:1000 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Dihydrochlorid (DAPI) for 5 min (1:100, #D1306, Invitrogen, Waltham, US). Samples were mounted on glass slides and z-stacks were acquired using an LSM900 confocal laser scanning microscope (Carl Zeiss ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 ml additional L-glutamine (Gibco, 25030–081; stock 200 mM), 10 ml MEM nonessential amino acids (Gibco ...
-
bioRxiv - Molecular Biology 2024Quote: ... in a an incubator (37°C, 5% CO2, Thermo Fisher Scientific) for 14 hours to induce ex vivo ovulation ...
-
bioRxiv - Neuroscience 2024Quote: ... the mastermix was made using 5 μL Fast SYBR Green (ThermoFisher), 1 μL of telomere A primer (1 μM) ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μL Power SYBR green PCR Master Mix (Applied Biosystems # 4309155), 2 μl dH2O and 2 μL cDNA sample ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5’- TTGGATCAGCTCAGACATATT-3’ or a nonspecific “scrambled” control (Invitrogen, United States). 72 hours after transfection ...
-
bioRxiv - Physiology 2024Quote: ... cells were detached via a 5 min exposure to Trypsin (Gibco), cell numbers were determined and cells were transferred into a particulate-free reaction tube containing 2.5 % agarose gel ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μl of a 50 mM sulforhodamine-101 (SR-101, Invitrogen/Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 5% fetal calf serum (FCS) (Gibco, Waltham, MA, USA), 0.5 ng/mL of recombinant human fibroblast grow factor-basic (FGF-basic ...
-
bioRxiv - Immunology 2024Quote: ... and the QuantStudio 5 Real-Time PCR Detection System (Thermo Fisher). The Throat Swab sample was analyzed for SARS-CoV-2-specific RNA by quantitative RT-PCR (qRT-PCR) ...
-
bioRxiv - Genomics 2024Quote: ... was dissolved in HPLC grade ethanol (Fisher Scientific, 64-17-5) to a final concentration of 30,000μg/mL and complexed to fatty acid-free (FAF ...