Labshake search
Citations for Thermo Fisher :
3051 - 3100 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... blocked for 45 min with 5% goat serum (ThermoFisher #16210064) in DPBS with 0.05% sodium azide (Sigma #S2002) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mL B-27 (without Vit-A, Gibco, #.12587-010), 2.5 mL N-2 (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5% v/v Horse Serum (heat inactivated, Invitrogen), Epidermal Growth Factor (Peprotech) ...
-
bioRxiv - Cell Biology 2024Quote: ... using a QuantStudio 5 RT-PCR System (Thermo Fisher Scientific). The following Taqman probes were used ...
-
bioRxiv - Bioengineering 2024Quote: ... anti-mouse Alexa Fluor 488 (5 µg/mL, A11029, Invitrogen) and anti-rabbit Alexa Fluor Plus 647 (5 µg/mL ...
-
bioRxiv - Cell Biology 2024Quote: ... on a QuantStudioTM 5 real-time PCR system (ThermoFisher Scientific). The 2-ΔCt method was used to analyze the data using glyceraldehyde 3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Biochemistry 2024Quote: ... with the following additives: 5 mL Penicillin/Streptomycin 100X (Gibco); 5 mL N2 growth supplement 100X (Gibco) ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were then quenched with 5% hydroxylamine (ThermoFisher Scientific, 90115) for 15 minutes before combining all samples ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 5% v/v Horse Serum (heat inactivated, Invitrogen), Epidermal Growth Factor (Peprotech) ...
-
bioRxiv - Neuroscience 2024Quote: ... Following blocking with 5% normal goat serum (Invitrogen, 16210- 072) for 20 minutes ...
-
bioRxiv - Pathology 2024Quote: ... and goat serum (GS) 5% (Thermo Fisher Scientific, reference 16210064) in 0,5 % PBS/Triton X-100 at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... washed 3 x 5 min with PBS (Gibco #14200-067) and fixed with 4 % (w/v ...
-
bioRxiv - Biophysics 2024Quote: ... and digested in 5 mL of 0.25% Trypsin-EDTA (Gibco) at 37°C in a 5% CO2 incubator for 15 min ...
-
bioRxiv - Bioengineering 2024Quote: ... Adenosine-5’-monophosphate (AMP) was purchased from Acros Organics (Belgium). Glycerol ...
-
bioRxiv - Cancer Biology 2024Quote: ... using a QuantStudio 5 Real-time PCR system (Applied Biosystems). PCR program ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% CO2 incubator in Neurobasal-A media (Thermo Fisher Scientific) supplemented with 0.5% penicillin/streptomycin (Lonza) ...
-
bioRxiv - Biochemistry 2024Quote: ... DAPI (Molecular Probes, 5 µg/ml, Thermo Fisher Scientific, D1306) was added for the last 5 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... DAPI (Molecular Probes, 5 µg/ml, Thermo Fisher Scientific, D1306) was added for the last 5 min ...
-
bioRxiv - Bioengineering 2024Quote: ... and stained with 5 µg mL−1 DAPI (D1306; Invitrogen). Next ...
-
bioRxiv - Genomics 2024Quote: ... 5 μL of Streptavidin C-1 beads (Thermo Fisher # 65001) was used to capture the Biotin Datp labeled DNA ...
-
bioRxiv - Immunology 2024Quote: ... CD64 PerCP-eF 710 (clone X54-5/7.1; Thermo Fisher), CD68 BV421 (clone FA/11 ...
-
bioRxiv - Neuroscience 2024Quote: ... reactions were supplemented as needed with 1-5% DMSO (Invitrogen) and/or 1M betaine (Thermo Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.25 µL of 5 U/mL Taq DNA Polymerase (Invitrogen), 0.1 µL of each 2.5 mM primer (forward and reverse primers ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... supplemented with 5% Horse Serum (Thermo Fisher, Waltham, MA, USA), 2.5mg/mL HEPES (Thermo Fisher ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 ng/mL recombinant human EGF (Gibco Cat# PHG0311).(22 ...
-
bioRxiv - Cell Biology 2024Quote: ... 6 gram of 5% G-250 NativePAGE Sample additive (Invitrogen) was added per gram of mitochondria-enriched fraction ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL of TrackIt 50bp DNA ladder (Invitrogen, Cat. #10488043) was loaded into the first well ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 5% horse serum (Thermo Fisher Scientific, 16050-122), 20 ng/ ml epidermal growth factor (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2024Quote: ... using the QuantStudio 5 Real-Time PCR system (Applied Biosystems) with the following thermal cycling conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... brains were blocked with 5% Normal Mouse Serum (Invitrogen 31880) in PBST (PBST-NMS ...
-
bioRxiv - Neuroscience 2024Quote: ... astrocytes were passaged at ∼5 DIV using trypsin (Gibco, 25200056), centrifuged at 100 g for 5 minutes at room temperature ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.14 μL of 5 mM SYTO 41 (Thermo Fisher Scientific) was added to the sample by a 1,000× dilution ...
-
bioRxiv - Genomics 2024Quote: ... 0.1% Tween-20 (ThermoFisher Scientific, cat. no. 9005-64-5), 0.1% IGEPAL CA-630 (ThermoFisher Scientific ...
-
bioRxiv - Genetics 2024Quote: ... containing 5% Protein Free Hybridoma Medium (PFHM II; ThermoFisher Scientific). On day 0 ...
-
bioRxiv - Neuroscience 2024Quote: ... in a QuantStudio 5 real-time PCR system (Applied Biosystems) using the fast run mode settings ...
-
bioRxiv - Molecular Biology 2024Quote: ... and reaction was quenched by adding 5% hydroxylamine (Acros Organics) for 15 min ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). PCR product was fused by restriction enzyme-compatible ends with the CD8α-CD28-CD3ζ domain contained in the pcDNA3.1/V5-His TOPO TA (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... PCR generated amplicon libraries were obtained from 100 ng faecal DNA using the ITS1 primer set containing an overhang for the Illumina Nextera platform [forward] 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCTTGGTCATTTAGAGGAAGTAA and [reverse] 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCTGCGTTCTTCATCGATGC primers and Phusion High Fidelity DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA). A duplicate reaction in 20 μl was performed with following thermocycling conditions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The tryptic peptides were loaded at 5 μL/min onto a C18 trap column (Thermo Scientific, 100 µm ID×2 cm, 5 μm, 120 Å). Peptides were separated with PicoFrit columns (New Objective ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Biochemistry 2022Quote: ... in HPLC grade H2O) on a trapping column (Acclaim PepMap μ-precolumn, C18, 300 μm × 5 mm, 5 μm, 100 Ǻ, Thermo Scientific, Bremen, Germany). After sample loading ...
-
bioRxiv - Microbiology 2021Quote: ... membrane pellets were gently resuspended in 6 ml of resuspension buffer (25% [wt/wt] sucrose, 5 mM Tris, 30 mM MgCl2, 1 tablet of Pierce Protease Inhibitor Mini Tablets, EDTA-Free [Thermo Scientific], 5 U Benzonase [Novagen]), suspensions were incubated with gentle mixing for 30 min at room temperature to degrade DNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR reactions were carried out in 10 µL volumes using 5 ng of total template using PowerUp Syber Green Master) in a QuantStudio 5 Real-Time PCR System Mix (Applied Biosystems, Foster City, CA, USA).
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from freshly isolated peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was fused in tandem by restriction enzyme-compatible ends with the CD8α transmembrane domain and the CD28 and CD3ζ intracellular regions already available in the lab (CD32131R-CR) ...
-
bioRxiv - Immunology 2020Quote: ... Samples were injected on to a μ-Precolumn™ Cartridge (Acclaim PepMap100 C18, 5 μm, 100 Å, 300 μm ID x 5 mm from Thermo Fisher Scientific) and peptides resolved on an 360 μm OD x 100 μm ID fused silica tip packed with 12cm of Aeris Peptide 3.6 μm XB-C18 100Å material (Phenomenex ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Biochemistry 2023Quote: ... and blotted for 5 s with a blot force of 5 at ∼90% humidity and 8°C using a Vitrobot Mark IV (Thermo Fisher Scientific Inc., Waltham, USA) that was placed inside an anaerobic COY tent ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Genetics 2020Quote: ... using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) (21) and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity (36) ...