Labshake search
Citations for Thermo Fisher :
2601 - 2650 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... x 5 mm Acclaim PepMap µ-Precolumn (Thermo Fisher Scientific) and a 75 µm i.d ...
-
bioRxiv - Immunology 2020Quote: ... 5 % CO2 in a HERAcell 150i incubator (Thermo Fisher, USA).
-
bioRxiv - Developmental Biology 2021Quote: ... pH 7.5) containing 5 µg/ml Hoechst 33342 (Invitrogen, H1399) and 10 µg/ml 3,3’-dihexyloxacarbocyanine iodide (DiOC6(3) ...
-
bioRxiv - Microbiology 2021Quote: ... w/ 5% Fetal Bovine Serum (FBS) (Gibco Lot # A31605-01), referred to simply as “DMEM” in results ...
-
bioRxiv - Cell Biology 2020Quote: ... human recombinant Epidermal Growth Factor (5 ng/ml, ThermoFisher Scientific) and 0.15 mM CaCl₂ (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ml N2 supplement (ThermoFisher 17502048 or in-house prepared), 5mL GlutaMAX (ThermoFisher 35050061) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Then a mixture containing 5 μL 10X FastDigest Buffer (ThermoFisher), 3.13 μL BSA 2 mg/mL (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: ... and a QuantStudio 5 Real-Time PCR System (Applied Biosystems). Primers are listed in Table S3 ...
-
bioRxiv - Biochemistry 2022Quote: ... and a QuantStudio 5 Real-Time PCR System (Applied Biosystems). Ct-values were first normalised to those of ACT1 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mg/ml stock of DAPI (Fisher Scientific, cat #D3571) was prepared in water and used at 1:300 dilution ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 min rinses in Tris base (pH=8.56; Fisher Scientific). Sections were then blocked with normal goat serum and normal donkey serum in PBS-T (3% each ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with 5% fetal bovine serum (Thermo Fisher Scientific, 10082147) and 1x antibiotic-antimycotic (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and analyzed on QuantStudio 5 Real-Time PCR System (ThermoFisher), Samples were measured in triplicate from each animal for each gene of interest ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 ng of GeneRuler 1 kb DNA ladder (Thermo Scientific) was used as a standard for DNA length ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mL of Gentle Ag/Aβ elution buffer (Thermo Scientific) were applied ...
-
bioRxiv - Cell Biology 2022Quote: ... 200µL 5-Ethynyl-2’-deoxyuridine (EdU, Molecular probes; 3g/L) was injected intraperitoneally in pregnant females 2 hours before embryo isolation.
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 5% horse serum (New Zealand origin, Thermo Fisher), 10 μg/mL insulin ...
-
bioRxiv - Cell Biology 2022Quote: ... previously coated with 5 µg fibronectin (Life Technologies 33016-015). After 1 to 24 hours post seeding ...
-
bioRxiv - Genomics 2020Quote: ... 5 mL 100 mM sodium pyruvate (11360-070, ThermoFisher Scientific), 2.5 mL 1 M HEPES (SH3023701 ...
-
bioRxiv - Genomics 2020Quote: ... at 37°C and 5% g/ml streptomycin (Gibco, 15140) at 37°C and 5% CO2.
-
bioRxiv - Genomics 2020Quote: ... in 5 ml of DMEM/F12 (Life Technologies, Inc., 11320033) and stored at −20°C ...
-
bioRxiv - Genomics 2019Quote: ... 5 μl of SUPERase-In RNAse inhibitor (Ambion™ #AM2694) was added to the reaction ...
-
bioRxiv - Immunology 2019Quote: ... 2 µL of the primer mix (5 mM dNTP [Invitrogen] ...
-
bioRxiv - Physiology 2019Quote: ... at a final SYTOX Red concentration 5 nM (ThermoFisher, S34859). High- and low-fluorescence cells were sorted on a fluorescence-activated Influx cell sorter (BD Influx system) ...
-
bioRxiv - Bioengineering 2019Quote: ... to free carboxyl groups and 5 mM Sulfo-NHS (ThermoFisher). The solution was mixed periodically during the incubation period using a chilled 1cc syringe ...
-
bioRxiv - Neuroscience 2019Quote: ... incubation for 3-5’ in 3,3’ diaminobenzidine (DAB, Acros Organics) staining solution (0.025% w/v DAB ...
-
bioRxiv - Systems Biology 2020Quote: ... 5 μL of 20 mg/mL proteinase K (AM2548, Invitrogen) was added to the cells in lysis buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 5 µg of human Cot-1 DNA (ThermoFisher Scientific) and then denatured in deionized formamide (Merck ...
-
bioRxiv - Genetics 2019Quote: ... or 1 mg/ml 5-fluoroorotic acid (R0812, Thermo Fisher).
-
bioRxiv - Molecular Biology 2019Quote: ... 5′ capping (mMESSAGE mMACHINE™ T7 Transcription Kit, Thermo Fisher), and 3′ poly(A ...
-
bioRxiv - Microbiology 2019Quote: ... supplemented to contain 5% fetal bovine serum (FBS) (Life Technologies), and 2 mM L-glutamine (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 0.25 µL BbsI (BpiI) at 5 U/µL (Thermo Fisher), 1 µL vector and 1 µL annealed oligos.
-
bioRxiv - Synthetic Biology 2020Quote: ... 0.25 µL SapI (LguI) at 5 U/µL (Thermo Fisher) and plated on LB agar plates containing 100 µg/mL spectinomycin and 40 µg/mL of X-Gal ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 0.25 µL SapI (LguI) at 5 U/µL (Thermo Fisher), 1 µL of L0 DNA part and 1 µL of pUAP4 ...
-
bioRxiv - Neuroscience 2019Quote: ... 5% CO2 and 37°C in neuronal culture medium (Gibco Neurobasal medium supplemented with 1x Gibco B-27 supplement ...
-
bioRxiv - Biochemistry 2019Quote: ... UBC13 and MMS2 (5 μM) and Alexa Fluor Maleimide (Invitrogen) labeled UbS20C (20 μM ...
-
bioRxiv - Microbiology 2019Quote: ... oCaulo4: 5’/5Biosg/TGGTTCAGGAATATTCACCTG) and MyOne Streptavidin C1 Dynabeads (Invitrogen) as in (Li et al. ...
-
bioRxiv - Microbiology 2019Quote: ... Coverslips were mounted on 5 μL of Prolong Diamond (ThermoFisher) and set for 30 minutes at 37°C or overnight at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... and 5% FCS with Lipofectamine 3000 reagent (Thermo Fisher Scientific) or Transit LT-1 (Mirus ...
-
bioRxiv - Bioengineering 2019Quote: ... and hMSCs and MS-5 in MEM Alpha (Life Technologies). All medium were supplemented with 10 % heat-inactivated fetal bovine serum (FBS) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific) was used to assess the expression levels of the mRNAs ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 5.5 x 10-5 mol/L 2-mercaptoethanol (Gibco). For the endothelial potential assay ...
-
bioRxiv - Genomics 2020Quote: ... Cells were trypsinised for 5 minutes with TrypLE (Life Technologies) before being collected and spun down for 5 min at 300 g ...
-
bioRxiv - Genomics 2020Quote: ... Cells were trypsinised for 5 minutes with TrypLE (Life Technologies) before being collected and spun down for 5 min at 300 g ...
-
bioRxiv - Genetics 2021Quote: ... 5 μl Dynabeads MyOne Streptavidin T1 beads (Thermo Fisher Scientific) were combined and washed according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Samples were analyzed in triplicate on QuantStudio 5 (Thermo Fisher), with at least 2 independent samples for each experiment ...
-
bioRxiv - Genomics 2020Quote: ... 5 µg of RNA was treated with Turbo DNase (Ambion) for 45 min before cDNA synthesis using SuperScript III (Life Technology ...
-
bioRxiv - Genomics 2021Quote: ... Quantitative PCR was performed on the QuantStudio 5 (Thermo Scientific) using the GoTaq qPCR Mastermix (Promega) ...
-
bioRxiv - Immunology 2021Quote: ... for 5 min and mounted with Prolong Gold (Invitrogen, #P36930). Slides were imaged using the Vectra 3.0 spectral imaging system (PerkinElmer) ...
-
bioRxiv - Molecular Biology 2020Quote: ... or a QuantStudio 5 Real-Time PCR System (Applied Biosystems).