Labshake search
Citations for Thermo Fisher :
2551 - 2600 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... the primary neurons were incubated with secondary antibodies (anti-mouse-568, 1/1000, Molecular probes A11019 ...
-
bioRxiv - Developmental Biology 2024Quote: ... the primary neurons were incubated with secondary antibodies (anti-mouse-568, 1/1000, Molecular probes A11019; anti-rabbit-488, 1/1000, Molecular probes A11008), sir-actin (1/2000 ...
-
bioRxiv - Genomics 2024Quote: ... cells were transferred to hormone-depleted media consisting of phenol red-free RPMI (Gibco) with 10% charcoal-dextran stripped fetal bovine serum (Sigma-Aldrich ...
-
bioRxiv - Genomics 2024Quote: ... and 1% penicillin–streptomycin (Gibco).
-
bioRxiv - Microbiology 2024Quote: ... with 10% fetal bovine serum (FBS) (Gibco) and 1% penicillin-streptomycin (Gibco ...
-
bioRxiv - Genomics 2024Quote: ... RNA was extracted with Trizol LS (Ambion), fragmented with 0.2 N NaOH for 8 minutes on ice ...
-
bioRxiv - Genomics 2024Quote: T-47D and Ishikawa cells were cultured in RPMI 1640 medium (Gibco) with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Developmental Biology 2024Quote: A 3’-fragment of katna1 cDNA was isolated from a collection of 24-hpf zebrafish embryo mRNAs using the SuperScript® III One-Step RT-PCR system (Invitrogen) with the following forward and reverse primers ...
-
bioRxiv - Genomics 2024Quote: ... then RNA was extracted with Trizol (Ambion), followed by 3′ adapter ligation using T4 RNA ligase (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... All cells were harvested using 0.05% trypsin-EDTA (Gibco). The panel of U2OS cells stably expressing 53BP1-GFP (43 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RT-PCR product was cloned into the TOPO® TA cloning pcr4 vector (Invitrogen) and sequenced ...
-
bioRxiv - Genomics 2024Quote: ... and SUPERaseIn RNase Inhibitor (Ambion)] ...
-
bioRxiv - Developmental Biology 2024Quote: ... and imbedded in OCT (Fisher Scientific). Cryosections (8-9μm ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... USA) in miPSC medium: knockout DMEM with 4.5 g/ L d-glucose (Gibco, Grand Island, NY, USA), 10% knockout serum replacement (KSR ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA concentrations were determined using a Quant-iT™ dsDNA Broad-Range Assay Kit (Thermo Fisher Scientific) on a SpectraMax® iD3 plate reader running SoftMax® Pro 7 software ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 0.1 mM 2-mercaptoethanol (BME) (Life Technologies, Grand Island, NY, USA), and 0.02% ESGRO-LIF (Millipore ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Infectious plasmids were linearized with BglII (Fermentas, Vilnius, Lithuania) and transcribed into 5’-capped RNAs using SP6 mMessage mMachine® Kit (Ambion Inc., Austin TX, USA). Transcripts were precipitated (1.5 volumes of DEPC-treated water ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 1ul of each exudate sample was diluted in 24 ul of 6.4 pH 0.02 M potassium phosphate buffer and 10ul of this solution was added to a well of a 96-well flat-bottomed microplate (Thermo Scientific Nunc MicroWell) containing 100 ul of a 1.3 mg ml-1 solution of lyophilized Micrococcus lysodeikticus cells in potassium phosphate buffer ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The strain was cultivated in Thermo ScientificTM Biolite 25 cm2 cell culture flasks with vented lids (Thermo Fisher Scientific) in seawater cereal grass medium ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and RNA purity was determined using agarose gel electrophoresis and NanoDrop 2000 (Thermo Scientific). After RNA extraction ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... after DNase treatment (Thermo Scientific), the concentration was checked on NanoDrop Lite Spectrophotometer again and the quality of RNA was checked by gel electrophoresis (0.8 % (w/v ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... head kidney and gill samples were collected from each individual and placed in an RNAlater solution (Invitrogen) and incubated at 4°C for one week ...
-
bioRxiv - Bioengineering 2024Quote: Bovine pulmonary artery endothelial (BPAE) cells with stained F-actin and tubulin were acquired from Thermofisher (FluoCells prepared slide #2). F-Actin is labeled with Texas RED-X phalloidin ...
-
bioRxiv - Cancer Biology 2024Quote: ... 293FT cell line was obtained in June 2016 from ThermoFisher Scientific (Invitrogen™, Cat# R70007, RRID:CVCL_6911). LAPC4 (RRID:CVCL_4744 ...
-
bioRxiv - Developmental Biology 2024Quote: ... coli TOP10 competent cells (Invitrogen, Cat # C404010) and purified using the endotoxin free NucleoBond Xtra Midi kit (Macherey Nagel ...
-
bioRxiv - Cancer Biology 2024Quote: ... and IMDM (Iscove’s Modified Dulbecco’s Medium, Gibco™, Cat# 21056023) (LAPC4 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then incubated with FAS Mouse anti-Human (Clone: 4F8H6, Invitrogen) at 1:500 dilution and the appropriate fluorochrome-conjugated secondary antibody (Alexa Fluor 647 anti-mouse IgG1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... DMEM (Gibco™, Cat# 10569-010) (VCaP ...
-
bioRxiv - Cancer Biology 2024Quote: ... and a 1.0 mm thick microscope slide (Fisher Scientific). This selection of thicknesses for the cover glass ...
-
bioRxiv - Cancer Biology 2024Quote: ... LNCaP95 cells were grown in phenol-red-free RPMI medium (Gibco™, Cat# 11835030) supplemented with 5% charcoal stripped serum (Gibco™ ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5% charcoal stripped serum (Gibco™, Cat# 12676029). NCI-H660 was cultured in HITES medium (RPMI 1640 medium plus 5 μg /mL insulin ...
-
bioRxiv - Developmental Biology 2024Quote: ... Reverse transcription of mRNA was performed using SuperScriptIV (Invitrogen Cat# 18090010) with OligodT primer ...
-
bioRxiv - Cancer Biology 2024Quote: ... coupled to a Vanquish Flex Binary UHPLC system (Thermo Scientific). Mass calibrations were completed at a minimum of every 5 days in both the positive and negative polarity modes using LTQ Velos ESI Calibration Solution (Pierce) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were incubated in 1ml TrypLE medium (Life Technologies ref #12605-010) for 10 min on ice ...
-
bioRxiv - Developmental Biology 2024Quote: ... They were then washed in 1X HBSS (Invitrogen Cat# 14025), and permeabilized for 45 min at RT in 1X HBSS ...
-
bioRxiv - Cancer Biology 2024Quote: LTL331R cells were plated on 96-well plate (Thermo Scientific, Cat# 167425) at 15 K cells/well ...
-
bioRxiv - Cancer Biology 2024Quote: ... the genomic junctions flanking corresponding sgRNA binding sites were amplified with sequence-specific primers by PCR using Platinum Taq DNA Polymerase and the amplicons were cloned into pCR™2.1-TOPO™ plasmid with TOPO™ TA Cloning™ Kit (Invitrogen™, Cat# 450641) and Sanger-sequenced using the T7 promoter primer (TAATACGACTCACTATAGGG ...
-
Loss of the mitochondrial citrate carrier, Slc25a1/CIC disrupts embryogenesis via 2-HydroxyglutaratebioRxiv - Developmental Biology 2024Quote: ... Equal amount of protein lysate was loaded and separated in an SDS-polyacrylamide gel electrophoresis using Novex™ 4-20% Tris-Glycine Mini Gel (Invitrogen, XP04200PK2) and transferred to PVDF membrane (Millipore ...
-
bioRxiv - Developmental Biology 2024Quote: ... using DNA polymerase Platinum™ SuperFi™ (Invitrogen Cat# 12351010) and the SM31-SM32bis couple of primers (TTTCACTTTCTCTCTGCCTCTTACA ...
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were then incubated in the NGS for at least 4 hrs and incubated overnight at 4°C with secondary antibodies: goat anti-rabbit Alexa Fluor 488 (Invitrogen Cat# A11070; 1/400) and goat anti-mouse HRP-conjugated (Thermo Fisher Scientific Cat# G-21040 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and goat anti-mouse HRP-conjugated (Thermo Fisher Scientific Cat# G-21040; 1/300). Finally ...
-
Loss of the mitochondrial citrate carrier, Slc25a1/CIC disrupts embryogenesis via 2-HydroxyglutaratebioRxiv - Developmental Biology 2024Quote: ... Embryos were then minced with a sterile razor blade in the presence of TrypLE™ Express Enzyme (Gibco™, 12604021) following by 10 min incubation on a shaker at RT ...
-
bioRxiv - Developmental Biology 2024Quote: ... Fragments were cloned into blunt-end TOPO vector (Invitrogen Cat# 45024), transformed into E ...
-
bioRxiv - Cancer Biology 2024Quote: ... and DU145 cells were plated at 500 K cells per well on 6-well plates (Thermo Scientific™, Cat# 140675) coated with 10 µg/mL poly-D-lysine (PDL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitation of all metabolites was performed using Tracefinder 4.1 (Thermo Fisher Scientific RRID:SCR_023045) referencing an in-house glycolytic metabolite standards library using ≤ 5 ppm mass error.
-
bioRxiv - Developmental Biology 2024Quote: ... PCR on cDNA flanking the exon 38 was performed using DNA polymerase Platinum™ SuperFi™ (Invitrogen Cat# 12351010) and analyzed on gel electrophoresis before extraction ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then quickly washed two times with RPMI media with L-glutamine and without glucose (Gibco™, Cat# 11879020). Media was then changed to fresh RPMI with 10 mM [U]13C-glucose (Cambridge Isotope Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 mM DTT) supplemented with Halt Protease Inhibitor Cocktail and Halt Phosphatase Cocktail (Thermo Scientific™, Cat# 78440) and incubated for 30 min at 30°C in a pre-coated plate with an AMPK substrate peptide corresponding to mouse insulin receptor substrate-1 (IRS-1)(supplied as part of kit) ...
-
bioRxiv - Developmental Biology 2024Quote: ... on a QuantStudio3 system (Applied Biosystems). Each reaction was performed in technical triplicates and in 3 biological replicates ...
-
bioRxiv - Cancer Biology 2024Quote: ... Glycolytic stress test was done by sequential injection of glucose (Gibco™, Cat# A2494001), oligomycin ...