Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for 7H Cyclopenta c pyridin 7 one 5 6 dihydro 3 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2022Quote: ... cells were stained for activated caspase 3/7 kit (Invitrogen); 7-amino-actinomycin D (7AAD ...
-
bioRxiv - Cancer Biology 2024Quote: ... CellEvent Caspase-3/7 Green ReadyProbes™ Reagent (Invitrogen, R37111) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... a Caspase-3/7 assay kit was used (Invitrogen, C10427). Each tube was brought to a volume of 1 ml staining buffer and 1 μl of CellEvent Caspase-3/7 reagent was added ...
-
bioRxiv - Cancer Biology 2022Quote: ... CellEvent Caspase-3/7 Green Flow Cytometry Kit (Thermo Fisher) was used to measure fraction of apoptotic cells by flow cytometry (BD LSR Fortessa with HTS sampler) ...
-
bioRxiv - Biophysics 2023Quote: ... 7-Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen. USA), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC ...
-
bioRxiv - Cancer Biology 2023Quote: ... Invitrogen CellEvent Caspase-3/7 green detection reagent (C10423, ThermoFisher) was used as stated in manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... at 37°C and 5% CO2 with 6 mL HDF medium consisting of 1x Advanced DMEM (Gibco™), 1x Glutamax™ (Gibco™) ...
-
bioRxiv - Neuroscience 2023Quote: ... The injected individuals were kept at 18°C for 5 to 8 days in 6-well-plates (Nunc multidish no ...
-
bioRxiv - Cell Biology 2020Quote: ... Harvested equine explants were allowed to recover in 6-well plates for 3-7 days in the following control medium: DMEM/F12 medium (11330, Thermo Fisher Scientific, Waltham, MA), 10% fetal bovine serum (Seradigm 1500-500 ...
-
bioRxiv - Genomics 2024Quote: ... HAECs at low passage (passage 3-6) were treated prior to harvest every 2 days for 7 days with either 10 ng/mL TGFB2 (ThermoFisher Scientific, cat. no. 302B2002CF), IL1B (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... Genital ridges from 1-2 litters (7-8 embryos per litter) were dissected out and digested at 37°C for 3 min using TrypLE Express (Thermo Fisher Scientific). For E9.5 and E10.5 stages ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Microbiology 2023Quote: ... Cells were passaged every 6-7 days applying 0.5 mM EDTA (Thermofisher) in sterile Dulbecco’s Phosphate Buffered Saline (DPBS ...
-
bioRxiv - Physiology 2024Quote: ... and the QuantStudio 6 and 7 Real-Time PCR System (Applied Biosystems), using the default protocol for comparative Ct studies ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Cancer Biology 2024Quote: ... overnight incubation in a cold room (6-7°C) was carried and anti-mouse/rabbit secondary antibody Alexa-488 conjugated (Thermo Fisher Scientific, Waltham, MA) incubation was performed (1 hour ...
-
bioRxiv - Evolutionary Biology 2021Quote: For ethanol preference assays, experimental substrates were 1% agarose and contained 75mM sucrose and increasing concentrations (3%, 5%, and 7%) of ethanol (ThermoFisher #BP2818); control substrates were 1% agarose and contained 75mM sucrose.
-
bioRxiv - Microbiology 2024Quote: ... the samples were stained with 80 μL CellEvent Caspase 3/7 Green detection Reagent 2 µM in PBS with 5% FBS (Invitrogen, C10423) and then incubated for 30 minutes at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... To detect sinapoylmalate and intact indole-3-methyl glucosinolate (I3M) contents, an AcclaimTM RSLC120 C18 column (100 mm x 3 mm, 2.2 µm) (ThermoFisher Scientific, MA) was used in conjunction with mobile phases consisting of solvent A (0.1% formic acid (v/v ...
-
bioRxiv - Developmental Biology 2019Quote: The compound 5-(and-6)-carboxy-2’,7’-dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA, Image-iT LIVE Green Reactive Oxygen Species Detection Kit, Molecular Probes; Invitrogen, I36007) was used to visualise the in vivo production of ROS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were washed then incubated in 8 μM of the ROS sensitive probe 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate acetyl ester (CM-H2DCFDA) (Molecular Probes, Eugene Oregon), for 45 minutes ...
-
bioRxiv - Plant Biology 2022Quote: ... Each sample was incubated with 50 µm of 2’,7’-Bis-(2- carboxyethyl)-5-(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM; Molecular Probes, Eugene, OR) at 28°C ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Cell Biology 2019Quote: ... methoxy]-2-oxyethyl] amino]-5-methyl-phenoxy] ethoxy]phenyl-N-[2-[(acetyloxy) methoxy]-2-oxyethyl]-(acetyloxy) methyl ester (Fluo-4/AM) were from Molecular Probes (Invitrogen, Eugene, OR, USA). M ...
-
bioRxiv - Cell Biology 2024Quote: COS-7 cells were grown at 37°C with 5% CO2 in complete Dulbecco’s Modified Eagle’s Medium (DMEM) (Thermo Fisher Scientific, USA) containing 10% FBS (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: Primary cortical neurons were maintained for 7 days (DIV 7) before EV treatment at 37°C in 5% CO2 and cultured in serum-free Neurobasal medium (Life Technologies) supplemented with 1.2% GlutaMAX-I (Life Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μL 7-AAD (Invitrogen, 00-6993-50). 7-AAD- ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μL 7-AAD (Invitrogen, 00-6993-50). 7-AAD- ...
-
bioRxiv - Immunology 2023Quote: ... 5 μl of 7-AAD (Invitrogen, 00-6993-50) was included for dead cell exclusion.
-
bioRxiv - Biophysics 2019Quote: ... N-((2-(iodoacetoxy)ethyl)-N-Methyl)- amino-7-Nitrobenz-2-Oxa-1,3-Diazole (IANBD ester) and Oregon Green 488 maleimide were purchased from LIFE TECHNOLOGIES LTD (Paisley ...
-
bioRxiv - Plant Biology 2024Quote: ... Chlorophyll content was measured using a NanoDrop™One/One C Microvolume UV-Vis Spectrophotometer (ThermoFisher) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... and 3-6 μl Lipofectamin 2000 (Life Technologies). See the Supplemental Information for detailed description.
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... coverslips were washed once with 0.1M MOPS buffer (pH 3) and stained with 50 μg / ml 5,(6)-Carboxyfluorescein Diacetate (CFDA) (Invitrogen) in MOPS buffer for 1 h at 37°C in the dark ...
-
bioRxiv - Neuroscience 2024Quote: ... C - 3 days (Neurobasal media (Gibco) + N2 supplement (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-\56-FAM\ CCT ACC TTA ACC TCC C-3’ with Minor Groove Binder (MGB; ThermoFisher Scientific). PCR was performed using 10X Master Mix to yield a final volume of 25 µl and final working concentrations of 16.6mM (NH4)2SO4 ...
-
bioRxiv - Neuroscience 2022Quote: ... 5′-CCCAAGACTTCCACCTACATTC -3′ (Tm = 62°C) and subsequently subcloned into PCR II-TOPO-TA cloning vector (Invitrogen). Riboprobes were generated with a BIOT-NTP labeling kit (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... for 3 hours at 37 °C before transforming 5 μL into TOP 10 chemically-competent bacteria (Invitrogen). Mutations were confirmed in selected clones by DNA sequencing ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
bioRxiv - Cell Biology 2024Quote: Sodium salt of 3-methyl-2-oxobutanoic acid (KIV; cat # AC189720050) was purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Bioengineering 2021Quote: ... and Heparin scaffold conditioned media groups (n=5) across 21 days (Days 0, 3, 7, 14, 21) using a RNAqueous™-Micro Total RNA Isolation Kit (ThermoFisher Scientific). RNA was then reverse transcribed to cDNA using a QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: 10 uL of either Caspase-3 or −7 library glycerol stocks was used to inoculate 5 mL of auto-induction media (Invitrogen Magic Media) and allowed to incubate and express for 18 hours at 30 °C ...