Labshake search
Citations for Thermo Fisher :
1451 - 1500 of 7168 citations for 6 HYDROXY 7 METHYLPURINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... Cells were allowed to grow for 7 days and then quantified using CyQUANT (Invitrogen) according to manufacturer’s directions ...
-
bioRxiv - Biophysics 2020Quote: ... Unreacted biotin was removed with Zeba Spin Desalting Columns (7 MWCO, Thermo Fisher Scientific). Biotin-labeled proteins were immobilized on the streptavidin (SA ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR analysis of gene expression was performed on the ViiA 7 system (Applied Biosystems) with the Applied Biosystems TaqMan Advanced Master Mix (Applied Biosystems #4444963) ...
-
bioRxiv - Genomics 2020Quote: ... All qPCRs were thermocycled on a ViiA 7 Real-Time PCR System (Applied Biosystems) as follows ...
-
bioRxiv - Physiology 2021Quote: ... Huh-7 cell line was maintained in Dulbecco’s modified Eagle medium (DMEM, ThermoFisher Scientific), supplemented with 10 % FBS and 1 % Penicillin-Streptomycin at 37 °C in 5 % CO2 ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were cryosectioned at 7 μm and collected onto polylysine coated slides (Thermo Fisher). After microCT analysis ...
-
bioRxiv - Immunology 2019Quote: ... coli (5×108 CFU/mL) (7 μg/mL, BacLight, Molecular Probes, Eugene, OR, USA). Fluorescence was assessed after 60 min (37 °C ...
-
bioRxiv - Plant Biology 2020Quote: ... and the QuantStudio™ 7 Flex Real-Time PCR System (Life Technologies Corporation, USA). Primers specific for the examined HSP-encoding genes (Table S1 ...
-
bioRxiv - Genomics 2021Quote: ... After adding the RT mix (7 µl H2O, 4 µl 5x RT buffer [Invitrogen] ...
-
bioRxiv - Cell Biology 2021Quote: ... The adherent cells were collected on day 7 using TrypLE select enzyme (Fisher Scientific) with 0.3% pluronic acid ...
-
bioRxiv - Neuroscience 2021Quote: ... media was changed to Retinal Differentiation Media (RDM) [7:3 DMEM (Gibco 11965-118):F12 (Gibco #11765-054) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and carried out on an Applied Biosystems Vii 7 RT-PCR system (Life Technologies). Validated gene-specific primers can be found in Extended Data Table 2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by qPCR amplification (Viia 7 Real-time PCR System, ThermoFisher Scientific, Waltham, MA) targeting the mitochondrial DNA marker rrnL ...
-
bioRxiv - Developmental Biology 2021Quote: ... Triplicate SYBR qRT-PCR assays were performed on the QuantStudio 7 machine (Applied Biosystems), and relative level of expression was calculated after normalisation to Tbp ...
-
bioRxiv - Cell Biology 2019Quote: ... the carboxylated analog of the cell-permeant agent 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Thermofisher) was used ...
-
bioRxiv - Immunology 2020Quote: LLC-MK2 cells (ATCC CCL-7) were maintained in Opti-MEM (Thermo Fisher Scientific) supplemented with 2% fetal bovine serum and grown in 225-cm2 flask at 37 °C in a CO2 incubator ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCR was performed on a QuantStudio 7 Flex Real-Time PCR System (ThermoFisher). Comparative CT analysis (ΔΔCT ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were incubated with 2’,7’-dichlorodihydrofluorescein diacetate (DCF-DA) (10µM; Invitrogen, Carlsbad CA) 4 hours before harvest ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dead cells were excluded either via 7-aminoactinomycin D staining 1:1000 (7AAD, Invitrogen) or Sytox AAD (1:5000 ...
-
bioRxiv - Bioengineering 2021Quote: ... The reaction was run in an Applied Biosystems QuantStudio 7 Flex System (Thermo Scientific) using the following condition ...
-
bioRxiv - Biophysics 2020Quote: COS-7 cells (ATCC) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; GIBCO/BRL) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RT-qPCR was performed in the ViiA 7 Real-Time PCR system (Applied Biosystems), using PowerUp SYBR Green Master Mix (A25918 ...
-
bioRxiv - Immunology 2020Quote: ... MCF-7 cells were labeled with the fluorescent lipophilic dye CM-Dil (Molecular Probes) according to the manufacturer's instructions with minor modifications ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative PCR were performed in a ViiA 7 Real-Time PCR System (Applied Biosystems) with the QuantStudio Real Time Software v1.3 ...
-
bioRxiv - Immunology 2020Quote: ... 2 mM EDTA and 1 µl of 7-AAD (Thermo Fisher, Waltham, MA, USA). 7-AAD-positive cells were quantitated by flow cytometry and analyzed with FloJo software (FloJo LLC. ...
-
bioRxiv - Genetics 2020Quote: ... and run in a QuantStudio 7 Flex Real-Time system (Applied Biosystems, catalogue 448598). Primer sequences to determine KD levels of TRAFD1 were 5’ GCTGTTAAAGAAGCATGAGGAGAC and 3’ TTGCCACATAGTTCCGTCCG ...
-
bioRxiv - Immunology 2022Quote: ... BMDMs were recovered at day 7 by scraping in PBS-EDTA 10 mM (Gibco) and centrifuged before counting and plating ...
-
bioRxiv - Developmental Biology 2022Quote: 7-day adipogenic induced cell populations were lifted with StemPro Accutase (Cat# A1110501, ThermoFisher). Lifted cells were pelleted and resuspended in 1.010 g/mL Percoll solution and loaded onto the top of the prepared Percoll Gradient ...
-
bioRxiv - Immunology 2022Quote: ... qPCR was performed in a ViiA 7 Real-Time PCR machine (Thermo Fisher Scientific) using TaqMan Universal PCR Master Mix and probes (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... The 7 μm frozen sections were generated with a cryostat (Cryostar NX70, Thermo Scientific) using Kawamoto’s tape method (Kawamoto ...
-
bioRxiv - Biochemistry 2022Quote: COS-7 cells were grown in 100-mm culture plates under DMEM media (Gibco) supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: 5-7 fattened adult female flies were dissected in Schneider’s Medium (ThermoFisher, catalog #21720001) supplemented with 20% fetal bovine serum and 1x antimycotic/antibiotic (VWR ...
-
bioRxiv - Bioengineering 2022Quote: ... MCF-7 and NIH/3T3 cells were maintained Dulbecco’s Modified Eagle Media (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: COS-7 cells were transfected with the plasmid using Lipofectamine 2000 (Thermo Fisher Scientific). Transfection conditions are described in each experiment ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time PCR was performed on ViiA 7 Real-Time PCR System (Thermofisher Scientific), using Powerup SYBR Green MASTER MIX (Applied Biosystems) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were run on a QuantStudio™ 7 Flex Real-Time PCR System (ThermoFisher). As described previously ...
-
bioRxiv - Plant Biology 2022Quote: ... and samples were run on a ViiA 7 Real-Time PCR System (Applied Biosystems) according to manufacturer’s specifications ...
-
bioRxiv - Developmental Biology 2022Quote: cDNA synthesis for primary let-7 was done using SuperScript III Reverse Transcriptase (Invitrogen). 250ng of RNA was used for cDNA synthesis in the Eppendorf Mastercycler Pro S6325 ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR was performed on a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems) using TaqMan assays (Thermofisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was conducted using ViiA™ 7 Real-time PCR System (Applied Biosystems, USA) to confirm DEcircRNAs and DElncRNAs between the treatment and control groups ...
-
bioRxiv - Microbiology 2022Quote: ... and were run in a ViiA 7 Real-Time PCR System (ThermoFisher Scientific, Canada). The cycling conditions consisted of an initial denaturation of 2 minutes at 94°C ...
-
bioRxiv - Biophysics 2022Quote: African green monkey kidney cells (COS-7) were cultured in DMEM-Glutamax (Gibco 10566016) supplemented with 10% FBS in a cell culture incubator (37°C and 5% CO2) ...
-
bioRxiv - Neuroscience 2024Quote: RNA has been extracted from myotubes differentiated for 7 days using Trizol (Life Technologies) followed by Chloroform/Isoamyl alcool (49:1 v/v) ...
-
bioRxiv - Plant Biology 2024Quote: ... was used on the ViiA 7 Real-Time PCR System (Thermo Fisher Scientific, America). Data was analysed with QuantStudio 6 and 7 Pro Real-Time PCR Systems Software (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2024Quote: ... Samples were analyzed on a ViiA 7 Real-Time qPCR System (Thermo Fisher Scientific), and relative expression levels were normalized to a standard reference gene (18s rRNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative PCR was performed on the ViiA 7 Real-Time PCR System (Life Technologies) using the QuantiFast SYBR Green PCR Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative PCR was performed on the ViiA 7 Real-Time PCR System (Life Technologies) using the Luna qPCR Master Mix (NEB) ...
-
bioRxiv - Neuroscience 2024Quote: ... qPCR was performed using the QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). Amplification was performed using a two stages procedure (hold stage at 95 ℃ ...
-
bioRxiv - Neuroscience 2024Quote: qPCR was performed on a Quantstudio 7 Flex Real-Time PCR System (Applied Biosystems) using Power SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... the medium was switched to SFRM (DMEM/F12 [7:3] supplemented with B27 (Invitrogen), 2 mM L-glutamine).