Labshake search
Citations for Thermo Fisher :
51 - 100 of 7262 citations for Human IL 17 Receptor since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Human IL-13 (Lubio Science) was diluted in OptiMem (ThermoFisher) and applied at 50ng/ml ...
-
bioRxiv - Immunology 2022Quote: ... and IL-2 Human Uncoated ELISA Kit (88-7025, Invitrogen) were used according to the manufacturer’s protocol and the signal was obtained in a microplate reader (Sunrise ...
-
bioRxiv - Cell Biology 2024Quote: ... A human IL-6 ELISA kit (Thermo Fisher Scientific, KHC0061) was then used as instructed by the manufacturer to measure IL-6 concentrations ...
-
bioRxiv - Cell Biology 2020Quote: ... Released IL-1β was quantified using the Human IL-1 beta ELISA Ready-Set-Go! Kit (ThermoFisher) following the manufacturer’s instructions ...
-
Incidence of an intracellular multiplication niche amongst Acinetobacter baumannii clinical isolatesbioRxiv - Microbiology 2021Quote: ... The concentration of IL-6 was quantified by ELISA (Human IL-6 ELISA Ready-SET-Go!, Thermofisher) by following the supplier’s protocol.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Human V1A Receptor-CHO cell line (CHO -V1a) was cultured in Ham’s F12 (Life Technologies) supplemented with 10% fetal bovine serum (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cells were stained with human FITC conjugated transferrin receptor (CD71; ThermoFisher: 11-0719-42) and human FITC conjugated glycophorin A (CD235a ...
-
bioRxiv - Immunology 2023Quote: ... TNF-α and IL-17 were measured in the culture supernatant using a cytokine measuring kit (Invitrogen, USA) [33].
-
bioRxiv - Cancer Biology 2022Quote: ... human antibody HLA-A,B,C (1:100, W6/32, #17-9983-42) (Thermo Fisher). To distinguish live/dead cells ...
-
bioRxiv - Immunology 2022Quote: ... 100 ng/mL Human Recombinant IL-4 and 250 ng/mL Human Recombinant GM-CSF (ThermoFisher) for six days at 37°C and 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... IL-1β secretion from PMA-THP1 was detected using IL-1 beta Human ELISA kit (#KHC0011, ThermoFisher Scientific) and IL-1 beta Human ELISA kit ...
-
bioRxiv - Immunology 2024Quote: ... IL-18 and human IL-1β was analyzed in the cell culture supernatant by commercial ELISA kits (Invitrogen) following the manufacturer’s recommended procedures.
-
bioRxiv - Cell Biology 2020Quote: ... containing 10 ng/ml recombinant human IL-2 (Gibco, Thermo Fisher), 10% heat-inactivated Fetal Calf Serum (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 10 ng/ml recombinant human IL-2 (Gibco, Thermo Fisher), 10% heat-inactivated Fetal Calf Serum (Gibco ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 2.5 ng/mL of recombinant human IL-2 (Thermofisher, PHC0027). T-cells were co-cultured with the mCherry-Nucleus-7 MCF7 cells in the presence of CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher ...
-
bioRxiv - Bioengineering 2024Quote: ... 5250 ng/mL human recombinant IL-6 protein (Invitrogen; Waltham, MA) was added to the experimental group and an equal volume of 1X PBS was added to the control group ...
-
bioRxiv - Cell Biology 2024Quote: ... SASP factors: human IL-8 Uncoated ELISA (88-8086-88, Invitrogen), human IL-6 Uncoated ELISA (88-7066-88 ...
-
bioRxiv - Immunology 2024Quote: ... and ELISA analysis (human IL-1β ELISA Kit, Thermo Fisher Scientific) according to the manufacturer ‘s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Immunology 2024Quote: ... and human IL-6 (Gibco, PeproTech, #200-06; 20 ng/mL). Prostaglandin E2 (PGE2 ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Genetics 2023Quote: ... androgen receptor (Invitrogen), PTK2 (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: ... APC anti-human CD25 (17-0259-42) and 2-NBDG (N13195) were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Developmental Biology 2022Quote: ... CD31-APC with human specificity for HUVEC experiments (1:500, Thermo Fisher Scientific, 17-0319-42) together with its IgG1 kappa APC-Isotype control (1:500 ...
-
bioRxiv - Biochemistry 2023Quote: ... The level of IL-8 in cell culture supernatants was determined using a human IL-8 ELISA kit (Invitrogen).
-
bioRxiv - Molecular Biology 2021Quote: ... and digested in Collagenase-I (Fisher scientific, 17-100-17)/Dispase (Corning ...
-
bioRxiv - Immunology 2021Quote: Human interleukin two (IL-2) Ready-SET Go! ELISA kit (eBioscience/Invitrogen) and Nunc MaxiSorp 96-well plates (Thermo Fisher ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-human α-synuclein 1:1000 (Thermo Scientific; Rockford, IL, USA); goat anti-luciferase 1:5000 (Abcam ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the supernatant was used in a human IL-2 ELISA (Invitrogen), human IFN-gamma ELISA (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... sodium pyruvate and 17-(dimethylaminoethylamino)-17- demethoxygeldanamycin (17-DMAG; Cat. Code: ant-dgl-5) were purchased from Invitrogen. DMEM ...
-
bioRxiv - Immunology 2021Quote: IL-17a ELISAs were performed using Human IL-17A (homodimer) ELISA Ready-SET-Go!™ Kit (Invitrogen™; eBioscience™), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... and incubated with anti-mouse/human CD309 (Flk-1/VEGFR2)-APC (Thermofisher, 17-5821-81; 1:100) for 30 minutes at 4°C ...
-
bioRxiv - Systems Biology 2023Quote: ... Cells were stained with the following fluorochrome-conjugated anti-human Abs: anti-CD4 (Invitrogen 17-0049-42), anti-FOXP3 (eBioscience 25-4777-61) ...
-
bioRxiv - Microbiology 2024Quote: ... The cells were pelleted (400 x g for 10 minutes) and used further for analysis of cytokine mediators IFN-γ and IL-17 (ThermoFisher) for ELISA analysis ...
-
bioRxiv - Neuroscience 2024Quote: A synthetic DNA geneblock for the human PAC1R-null receptor sequence (PAC1R) was designed and ordered (Life Technologies) based on the NCBI protein data bank entry “NP_001109.2” ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 50 ng/ml human recombinant M-CSF (ThermoFisher Scientific, Rockford, IL, USA). After six days of PBMC culture ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The ELISA was performed using Human IL-1β high sensitivity kit from Invitrogen Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... and mouse anti-human α-synuclein 1:1000 (Thermo Scientific; Rockford, IL, USA) or goat anti-luciferase 1:250 (Novus Biological ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The ELISA was performed using Human IL-1β high sensitivity kit from Invitrogen. The sample of ELISA used in the present study consist of cell culture media (referred to as sample hereafter ...
-
bioRxiv - Immunology 2024Quote: ... at a 1:1 ratio and recombinant human IL-2 (Peprotech, ThermoFisher Scientific), and expanded in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The ELISA was performed using Human IL-1b high sensitivity kit from Invitrogen. The samples for ELISA were media collected after treating the cells with drugs at 100uM ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Colorimetric protein assays were conducted using commercial human IL-8 ELISA and mouse IL-6 ELISA kits (Invitrogen; 88-8086, 88-7064) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Supernatant was harvested at the indicated timepoints and IL-2 levels in the supernatant were measured via IL-2 Human Instant ELISA kit (Thermo Fisher #BMS221INST). T-cell proliferation was also measured at the indicated timepoints using a BD FACSymphony Fortessa X-50.
-
bioRxiv - Biochemistry 2023Quote: ... Detection of bound Af2-IL was performed using a rat anti-human IL-2 mAb Alexa Fluor488 conjugate (Invitrogen, Carlsbad CA, USA). Cell nuclei were counterstained with DAPI (Sigma Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... The level of IL-8 in cell culture supernatants was determined using a Human IL-8 Uncoated ELISA kit (Invitrogen, ThermoFisher Scientific Inc.).
-
bioRxiv - Neuroscience 2019Quote: Silencing lentiviral vectors were produced by co-transfecting HEK293T producing cells with lentiviral silencing plasmids GIPZ Human histamine H3 receptor shRNA (Clone V3LHS_638095 or Clone V3LHS_638091, Thermo Scientific) with packing plasmid psPAX2 and envelope coding plasmid pMD2.G (Addgene#12260 and #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... Transferrin (loading control) was detected with mouse anti-human transferrin receptor antibody (1:500, Cat# 136800, Invitrogen, Waltham, MA). Protein samples (50 µg ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The ELISA was performed using Human IL-1ẞ high sensitivity kit sold by Invitrogen. The sample for our ELISA consisted of cell culture media (referred to as sample hereafter ...
-
bioRxiv - Immunology 2022Quote: ... Human and mouse IL-1β secretion was quantified by ELISA kits (Thermo Fisher Scientific) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... ELISA was performed with Human IL-8 ELISA Ready-SET-Go kit (Affymetrix eBioscience) according to manufacturer’s protocol.