Labshake search
Citations for Thermo Fisher :
901 - 950 of 5415 citations for Cytomegalovirus Purified Antigen since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA was purified using a GeneJET PCR purification kit (Invitrogen). Immunoprecipitated DNA was mixed with SsoAdvanced Universal Sybr Green supermix (Biorad ...
-
bioRxiv - Genomics 2024Quote: ... Labeled fragments were purified using Dynabeads MyOne Streptavidin C1 (Invitrogen) washed and eluted by incubation in 150 mM NaOH for 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... and recombinant proteins were purified using Ni-NTA agarose (ThermoFisher), then buffer exchanged into PBS and concentrated using Amicon Ultracel centrifugal filters (EMD Millipore).
-
bioRxiv - Microbiology 2024Quote: ... whole-cell RNA was purified using TRIzol reagent (Fisher Scientific) according to the manufacturers protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... RNA was purified using neutral phenol/chloroform/isoamylalcohol (Ambion, AM9722) followed by chloroform (Serva ...
-
bioRxiv - Cancer Biology 2024Quote: ... and purified with HisPur Ni-NTA affinity resin (ThermoFisher Scientific). Protein was analyzed by size exclusion chromatography (Superdex 200 Increase 10/300 GL column ...
-
bioRxiv - Zoology 2023Quote: Amplicons were purified with ExoSAP-IT (Applied Biosystems, Waltham, MA) and sequenced using a 3130/3130xl Genetic Analyzer (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting plasmid was purified by Midiprep (Thermo Fisher Scientific), and the insert sequence was determined by Sanger sequencing ...
-
bioRxiv - Immunology 2023Quote: Purified hCD8+ or mCD8+ were activated using Dynabeads from ThermoFisher Scientific per manufacturer’s instructions or using plates coated with αCD3 antibody ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... mRNA was purified using Dynabeads oligo(dT) magnetic separation (Invitrogen). RNAseq Library Prep ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified using the PureLink™ HiPure Plasmid Miniprep Kit (Invitrogen), into the gonad of 1 day-old adult animals of the MosSCI acceptor strains ...
-
bioRxiv - Plant Biology 2023Quote: ... The overexpressed protein was purified using HisPur NiNTA resin (ThermoFisher). For removal of the HisMBP tag ...
-
bioRxiv - Microbiology 2023Quote: ... The purified VLP fraction was treated with DNase I (Ambion) at 37 °C for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was purified by Streptavidin C1 magnetic beads (ThermoFisher #65002) in Biotin Buffer (100 mM Tris ...
-
bioRxiv - Developmental Biology 2023Quote: ... biotinylated amplicon is purified using MyONE C1 streptavidin beads (Thermofisher), removing unwanted DNA ...
-
bioRxiv - Biochemistry 2023Quote: ... Purified bacmid DNA was transfected into Sf9 insect cells (Invitrogen) to produce secreted recombinant baculovirus ...
-
bioRxiv - Neuroscience 2023Quote: ... and purified by the MEGAclear Kit (ThermoFisher, Cat. No. AM1908), following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... and purified it with the MEGAclear Kit (Thermo Fisher Scientific). To produce the Cas9-mRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... All messages were purified using the MEGAclear Kit (Ambion, AM1908). mRNA concentrations were measured by NanoDrop and message integrity and in vitro polyadenylation was evaluated by electrophoresis ...
-
bioRxiv - Biophysics 2023Quote: ... and gel purified using an Invitrogen gel purification kit (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... coli (BL21) and purified using glutathione sepharose 4B (Fisher Scientific). Peak fractions were concentrated and further purified by gel filtration as previously described11 ...
-
bioRxiv - Neuroscience 2023Quote: ... and purified with an agarose gel extraction kit (Thermo Scientific). Gibson assemblies and ligations were performed per the manufacturer’s recommendations (Thermo Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... The resulting fragments were subsequently purified using Trizol reagent (Invitrogen) and precipitated in the presence of glycogen ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA was extracted and purified using TRIzol Reagent (Invitrogen) and then quantified and sequenced using the BGISEQ-500 platform by BGI Company (China).
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was purified from chromatin pellets in TRIzol Reagent (ThermoFisher) using the RNeasy Mini kit (QIAGEN ...
-
bioRxiv - Cancer Biology 2022Quote: ... Gel-purified products were sequenced on an ABI3130 (Applied Biosystems) and evaluated with SeqScape software v2.5 (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and purified with MEGAclear Transcription Clean-Up Kit (Thermo Fisher). All embryos were injected with approximately 1nl of solution consisted of mRFP-Caax (40ng/μl) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the products were purified using MEGAclear kit (Invitrogen, AM1908). DNA fragments for T7-CRISPR-Cas945 ...
-
bioRxiv - Genetics 2023Quote: Total RNA was purified using silica column-based kits (ThermoFisher). RNA quality and quantity were assessed via Bioanalyzer (Agilent) ...
-
bioRxiv - Immunology 2023Quote: ... TotA was purified using HisPur Ni-NTA Resin beads (ThermoFisher). MBP protein was cut using super TEV protease and both proteins were removed using HisPur Ni-NTA Resin beads ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was purified from P0 cerebral cortices using TRIzol (Invitrogen) according to the manufacturer’s instructions followed by reverse transcription by SuperScript II (Thermo Fischer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... RNA was extracted and purified using TRIzol Reagent (Thermo Fisher) and a PureLink RNA Mini Kit with PureLink DNase digestion on column (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was purified from the lysate using TRIzo (ThermoFisher, 15596018) and quantified on NanoDrop ...
-
bioRxiv - Bioengineering 2023Quote: ... beads purified and quantified using Qubit dsDNA BR (Thermo Fisher). Library was sequenced on an Illumina MiSeq instrument using Illumina MiSeq Reagent Kit v2 Micro (300-cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... and hybrids were purified using MyOne-C1 Streptavidin Dynabeads (Invitrogen). Ligated probes were eluted by treatment with RNase H and RNase A ...
-
bioRxiv - Genomics 2023Quote: ... and purified using a Purelink quick PCR purification kit (Invitrogen). pLKO5.sgRNA.EFS.GFP (addgene #57822 ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNA was purified and quantified by Qubit (Thermo Fisher Scientific). About 1ng DNA was used for library construction using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and mRNA was purified with the MEGAclear kit (Invitrogen AM1908) and concentrated with an ammonium acetate precipitation ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Purified RNA (1µg) was used for DNase treatment (Thermo Scientific) and quantified with a Qubit 3.0 Fluorometer (Life Technologies).
-
bioRxiv - Microbiology 2023Quote: ... Purified RNAs were finally quantified by fluorimetry using RiboGreen (Invitrogen; Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... and purified by HisPur™ Cobalt resin (Thermo Fisher, 89966). SARS-CoV-2 RBD (Wu ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified by the BigDye XTerminator™ Purification Kit (ThermoFisher Scientific), separated by SeqStudio™ Cartridge v2 (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... and purified using Pierce C18 Spin Tips (Thermo Fisher PI84850). Peptide samples were dissolved in 0.1% (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... purified using the TURBO DNA-free Kit (Thermo Fisher Scientific), and concentrated using the RNeasy MinElute Cleanup Kit (QIAGEN ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was purified using neutral phenol/chloroform/isoamylalcohol (Ambion, AM9722) followed by chloroform (Serva ...
-
bioRxiv - Genomics 2023Quote: ... DNA was purified using GeneJET Gel Extraction kit (Thermo Fisher). For qPCR primer sequences see Supplementary Table 1 and Table 2.
-
bioRxiv - Immunology 2024Quote: ... noctula was purified using protein G agarose (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2024Quote: ... Purified products were cloned using TA Cloning Kit (Invitrogen, K204001.) and sequenced using primers T7 TAATACGACTCACTATAGGG and Neosplice_F2 AGTGACAACGTCGAGCACAG by AGRF Brisbane.
-
bioRxiv - Cell Biology 2024Quote: ... and the cDNA was purified with MyONE Silane beads (Thermofisher). Second DNA adapters containing unique molecular identifiers (UMIs ...
-
bioRxiv - Cell Biology 2024Quote: ... The purified RNAs were reverse transcribed using SuperScript IV (Invitrogen), and the cDNA was purified with MyONE Silane beads (Thermofisher) ...